Description :
From Genome Similarity Track
Location :
contig_5:3956- 6889
Transcript NameFunction/comments
g1490.t1hypothetical protein

Sequence
2933 bases(100 bases per row)
GGCCACGGCACTCCGAGCTGCGTGCACGGCGGCAACATATCAGGAACGTCGGCCACGGGACGCTGAACTTGGTGCCGGGCGGCAACAGCGTGTGCTGGAC
TTTGCGCACATGTTTACGGCGTCCACAGCGCGGGCGCGACGCGAAAGGACTTGGCGCACGACAGCTGCAGCTTGGGATGGACTGGGCGGCCGCAGTCTCA
GCGCGAATGGACTTGGTGAAGGAGGGAACGACGGACACAACGCGGCTGGCAGCGGCTGTCAAGGCCGTGGTGATGTCCAGAACGGCGCAGTTGGCCTACC
ACAGGAACGTCACGGGCACTGGGCTGCAGTTGGAGCTGACGCTGGCGATGATGGCCGAACAGATCCCGCGGCGATGGCCGTGGGTGCAACGCTGCCACTG
TGTTATTTGGGACGAGAAACACTTGTTGATAATGCTAAAGACATTGACCATAGTTTATTCGATATATATTCGGTCATGTTGCTCTGAAGGCATTAGCATA
CTTTAATCAAGATAAATACCCTCTTCTTTGCCTACAGAATGCGAATCATTGGAATATCTGTCGCGCAACTCTGCTGTCTTGACTCGCTGAATCTTCGCTG
AGCAACTCTGTACAATCACTACTGAAAAGTAGGTCGGTTTCGTCGACGGAGAGTACAGAACTGTCGCTCTGGGTCTCATAAGAGAGCACGACACTATCGC
TTTCGGGGATAGGGAGAGCTTTATCGACGGGTCTCGCGGCGCTACTTGCCTTCAACTTAGCCAGATGCGATGACCTGTTGACATTTCCATTGTCACTGAA
GAGGCCATTTGGGAGATAGAATCTGTGAAACTTATCCCAACAAGTCCAAGTGCTCTGTGGGCACGTGTACGGACTCTCGATGTATCCATGCACAGTGCTA
CAAAGACAAACAGTGTGCGTGAGGCAATAATCCGTCACCTCTGTAGGATATCTGCCCTCGTAGCGACACACAATGCACTGCCGACGTTTCCGCCCACTGT
CCTTGAACATTTGTTTCGAAGACATAGACTGACATCGCTTCAGGGCGCTGTGCGGGTTTGGCGAAGTGTACACTTTAGGAGTTATACCAGTTGCATCCAC
TGCTGCGGTTTCATCAGCAACACCGCTTCCAAACGCCATTTGACCATCGCTCGGGGCTTCTTGCCACCTGCCAGAAATTAGCTCAGATACTAATTCAGTG
ACAAACGTCCTGTGGGGATCTCGATCTCTGGAAGTGTCGATTGCCATCCGTCGAGTCAGGTACGCGTTGGACCGTGCAATATCCACTATTGCCAAAGCCA
ATTTTTTATGCCATTTTTTGAACGAATGACCATCAGCTAGTGAAAATCTAGCTCGTATCTGATCCAAACGATCAACACCTTGCATGTGTCGATTGTATTG
CAGGATACAGCTCGGAGCAGGAAACTCATGAGTATTTTTACCAACCCGCCGCGTGACTGTCGCGGCAGTAGATGCATCAGCATTGGTAACCATCATCACG
GTATTGCCATCGCACCACGACGCAGCGAGCAAGTTGTGCTCCAGGGAGACAGACTGCTGATAGTCACCCCTTGTTGAGTGCTCCTTCTGGAGAATAGTGT
GCTTCGGATAGTGCTTACTCCTTCCCCGAACAGTTCCCCGCCCATACAACCCCTTCAAACGCAAATCCAACAGCAACTGGACGCTTGTGTAATAGTTGTC
CATATTGATGATTCGTCGAGAGTAAAAGTAGGGCCTCACGACCTCTAGAACATGCTTACGCACTTGTTTGACATCCTCGAGCTCCTCACGAAGCTGCTGC
ACCTCTTCTAGGCTCACCACGTTTTGCAGGCGGTCCGCGATATCACTATTATTGCAGTGGAGGCGATAGTTCAAAGCGATCCACGTGGTCGAGCAGCACA
GCACGTACATACGAAAATGATACTTGCCGCCAGGTTTTGGGGATTGAACACGATAAGATGTCGTCCATGGCGGGACCGGCATGCGATACTCGCTTCGTCA
AGAGCCAAGTCACGGCCAGGCTCAACATAGCGACCACCAGTGCATTTGAGCAAATTCAATAGGGGCCTAATTCGGGCTGCTGGGTCTCGTTCCACAGCCG
ATCCCGGATCAGCGCGAAAGCTCAAACAGCGGCGAAGCAACTTGAATCTATTTAGACTCATCACATTGTCCAAGCTGGTAGATGCACCACCAAAAATCGC
ATCTTCAGTCTGTGGCCCCCAGTAGTTAGAGTACTCCCCCTTGTCAGTGAGGGTCAGATAAAGCATGATGCCGAGGAAGATCATCAGCTCTTCCATTGTA
AACGGCGTGGTGATTCGAACATTCTTGAGGGCTGCATATCGATTCGTCTCGAGAACCACTTGTTTCCAGAAGTAAATTGGAATGTAAGCGAAGAAGCTCG
AAGAGGCTGAGTGTGCAAACAGGTGACTGTACTCGGGTAGTAAGCGTGTACTAGTGCTCTCGTCCGTGTGTTCATACAGATCCGTGGGGCCATCCATATC
CACATCTGGCTGAAACCGCATACTGTTCACCGCTTCCACCTCCGCAAGGCTCACGGGCAAAAATCGCTCTGGATCGTACATTTCCATACCGTCGTCGTCT
GACGCGACTTCAAGTTCATCGAGCGGTTCCTCCATCTGCAGCTCCCCTTCCACCACTGTATCAGTCAATTCACGCCACGCCGGCTTGTTGGGTGAGCGCG
CGAGAGCCTGGTAGTTCTCGATCCCGCGCTGAATTACTGCCACACTCAGAGTTTCAACTGCATTCTGGAACTCCGTATCTAGCCAAATTACTTGTAGTAC
CCCTCCCTTCTTCGTCTTTTTGACCTGACGACACACACGGCCGACAATAAAGGCTGTGCCCACGCATCTATACACCTTTTCCTTCATCCACAATTCCTTT
GACGGTGAAAATGCCACCAGCTTCTTTAGGAAT