Description :
From Genome Similarity Track
Location :
contig_25:39558- 41326
Transcript NameFunction/comments
g6056.t1hypothetical protein
g6057.t1hypothetical protein
g6058.t1hypothetical protein

Sequence
1768 bases(100 bases per row)
CTGGCCTGGGCTACGCAAGACGACCCGATTCCCCAACATAGCTGAAATGCTTTCGCCTGCGTCGAAGTCGTCGTGCCAGATTTCGAAACAGGTCTTGTTC
ACGCCCTTGAAACTCCGCCGAGTTTTATTGCAGAGCCACAGCTTGGCGGTGTTCACCGAGCACCGCTCGCAAAAGAAGGTGGTGTTGTACGACTTTTTGG
CGTCCGCACGCAGCAGCGCATAGACCTTGCATGAGTGCTGCCGGCGCTTTTGGATGTCGCTAACTGTCAACCAACCCTCACTCTACTCGAGCAGGTGGGT
GATCCGGACCGGTGCACGCTTGCGCTGCCGGAAGCATGGCTGTGTGGCAACAACACCAGCGAAGACCTCGGCCTTCAGCTGCAGGAGATGATTCTGGAGT
ATTGCGTACCACTCCCCGCGGTTCATGACTGGTTTGCCAGCCATCACGGCTGCCTCGTGGTGGGGGATGAACGCGTTGACTACTGCTAGGTCGGTGAAGC
CAAGTAGCAAACTCTTATAGTACTTGGTGACCTTTGTCGACGTCTGCAAGGAGTATCGCTGGAGGCGGAGTTGGTCATGCACATCAATTCCCCTATCCAG
GTTTGGTAGATGGTCGCCGGTTTTGGACACGGTACCGTGATGGCGCTTGATTTTTCGCCCGATCGATGACTCGGACATGACCGCACCCGTGCACGGGTAG
TGCATTGGCTTGCGATCCCACCAGTGGAAGGCAAACCTGTTTGGAACGGCAAGCGAGCGTGAGAACGTGAATGTGCCACGGGGGATGTTTGCCGTACGGG
TCTTGCGCTTTTCGTTCACATTATTATCGTACCCCAATCGTTTGGTTATGATGGCGCCGATGACGTACACCCCCATGCCGAGAAAACTTAATGGAAGCAG
GACGGACGTGTAAAAGCGGTCGACGACGACGGCATGCCACTGATGGCGCGCGCTTGATCCGAGGACGATCTTCAGGTTGCGGACGACTGCTGCAGCACCT
GTCTTGTGATCAAATGAGGCATCTCCACCATCACCTGCTTTTCGCTTTCCAGCATAGAGCTCGAATCTAGTCGGATACGACATAGAGAGTTGACTTTGGA
CCCGTAAGTCGCAAGACACGACATCCGATTTCGTCCAAAAAGACTTACCTATGAAAGTACGCCGTCCTTGAGTCGCACGCCATAAATATTTTCATCCCCT
AGTGGTGAGGCTTGTACTTAAACATCCGCGTCGTGTTCCGAAGGGACGTCGACAGCAGCACACTTCCATCGAAGGAGAAGACTGCCGGGAGCGACCAGCC
CGCCAGGAACTGCTGCTGTAGCTTTGTCGCGACTGGTCGCAACTTCCAGAGCTTATCGCGCGAGCTAGGAGCCTCGTTGTCCACCACGTGAAAGTCCCGG
AGGATGTCCTGGCAACGGTTCCTCGACATGAATCGCCCGAAGTTTCCGGCTGGAAGCACTCCATCCTCGGCCATCGACCAGTGTGCAGAAAATCGCCGCT
TCTGTGAGCACAACATTTGCGCCACGAGTAGCCCGATTACATGCAAGATCCCGTGGGTCTGGTACCTTGGCTTCGCCTTTAGCCGGCGGTGGGTTTGGAC
CAGCGTCTCGCGCCGCGATGCGGTCTGCTTCGCCTGCATTGCCATGGCGCGGCGTTCAACTTGCTCGAGACTGTAACGGTTGGTCTCGACGTCGATGAGC
ACCCACAGCGGCTTGAGCATAAAGAAGAAGAATGACTCTAGTGGTGAGTCTTAGAGCGCGCGCAGCTC