Description :
From Genome Similarity Track
Location :
Scaffold_34:39556- 40639
Sequence
1083 bases(100 bases per row)
GGGTTCGCTGAGCCGCAAATTAAGCTGTGTGTGAGAGAGAGAGAGAGAGAAAGCGAGAGAGAAAGAGATAGATAGATAGATAGAGAGAGAGAGATAGAAA
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGCTAGCCTCACGCAAGCCAGTACGCCTC
TCCGCAAAGTTCTATTCTATACATACACTAATACAAAGCATGCTTTACAGTAAGTTGGTGTCGTCGTGAGCAGCACGACGGCACGGTCGCTCTTGTCCAA
CGATCGTAGTAAACTTGGTATAACCGCACACGTCCGCACGTGGCGCGTCGGTTAGTGCGCAGCCGTAGGCTGCAGCGTCAGGCGTAGGAAAAGATGCAGG
ATCGGCTGTCGGTGTCAATGCTGGGCACTGACAGTCCACTTTGTATGTACTGCTGGGCCTGGCCTCTTCCCACAGGGAATGGTATTTCATACGACAATCG
ATCTCTCTGTTCAACGTCTTGGGCTGTCAAGCACTTCAGCCATACGACACGAGCTACCCACGCTCCAGCAACGACGAACACGAAGCTATACTGTAACGGG
GTACGTAGCCCCAAGTGTACCCCTGATTACATGAAGTTTGAGACATCAGCACTTCGGGATACCTACCAGGGTCGTCAACCAGTGGCTGATGACATACTTT
ACTAAAGATGACTTGTAGTTTGTAAATTTAACTCAAGGTTAGCCTACCTATAAATACATCCAGTTTACAGCTTACCTTAAAGTGATCAAAGCAGATGCGG
AATTGACGCTTGAAGATCGCAGGTATAAGGTTACAAAGTCAATAGGTGTAAATCTGGTACCTATAGATAACAGTTTATTCCGACTTATAATACATTCCTC
TCCGCCAGATTTTGAGTGTCGAAGGGGTTTGAGATTCCCAGACGCACTAATTATGCACATTTATTCCTGCGTTCGAGATTTCAGACGGCAATCTGTGCTG
CGGGAATGTGTGAAAATTTTGCACGAAAAAAGCTAGACACTGTCAAACTTCTTCAAGAATATTTTTTTTTTAACTTCGCGTTT