Description :
From Genome Similarity Track
Location :
Scaffold_1:3955273- 3961035
Sequence
5762 bases(100 bases per row)
CGCGCAAACGCTCGCTCCGCCGTTAGATCGGGGTCGTGCATTTCTGCATCCCCTTCTCCTGCATCCAAAGAATAGTCCTGACCTCCTCTTAGTTCCTGTC
CACGTGTACGCCGCTCCATTTTATCCACCAACGCCAGCCACTCCATCGCTTGTCGCCCTTGTTGCTTCGATGCGACATTCTCTTGGGCATTTCTCCCTCT
GTCAACTGCCGTCTGCTTCTGTCCCTCCGCAATTGATCTATCGTGTTCTCTCTTCAGATCCAGCTCCTCGCTGTATTTCTTCGCCTCTTCCTCTCCTCTC
ATCGCCGTTGGGTGTTTCCGATTATGTCGAATCACCGTCACCACTGGCCGCTCCTTTGTCGGTGTCGTTGCGTGGCAATGTGTCCTCGTATGCTGGTACG
ACATTATGTCCTTCTCATGTGGCCTTGGAGTTTTAATCACCTCTTCAGGACTCTGCACCCTTCGCAGCCGCTCTATTTCCTCTCTGTCTTTCGCTCGTTG
CATGGCCACCTCCTGCTCCCGTTTGGCCCGAGCACTGGCTTGTTGTCTCTGTTGACCACTCAAGAGCCTCAATCTCTCCATATTTTGCTGCACCTGTCTT
TGTCTGGCCGTCCGCACTTGTTCCTCCTGCTCACGAGCATCTTCGGCCTCCATAGCTCGTTGTTTACCGGTAACCTGGCGGTTGTATTTCCACTTGTCTT
TCTCTTCGTGGGCCTGTTCCATTAGCTCGAGCATCTTCAGGCGCGCGTTCCGCTGTGCTGTACCCATGTTCTGCAGCGAGTACTGATACCGCACATGAAG
CTCCGTTAGCAGCTTCTGCTGCTCCATGTTCAATTGATTGTGGGCCCTTTTGCTCTTGCCGCGTTGCATTTTCTGTAAATTGTCCCGGTATCGTTGCGTC
ACTTGCTGCGCAAGACGCCGTTCCTGCTCGCGTACAGCCAAAAGACGGTGACGTCTACGCGCCGCCTCATCCTGACGTGAGTACAGCTCAATCTCACCCG
AGCTCAGCGGAATCTGGCCCAGAGAGCGGTTGCGCCTTCGTCGGACAGGTGCAGCCATCGACGGTTGAAATTATAAAGTTTGACATTTGAATTTGAAGTT
TAATGAAAATATTTGGGTTGTGGTTGTGATCATCAAAGCCAAACTTCAATGTGTAGCAAATTTCGGTACATTACATCATGTTCATGTTCTGTGTGTACTG
TATGTACTCAAAAGTTTTCCGGTGGATTCCGGTGGAATCTCCACCGGAAAACTTCCACCGTGGAATCCACGGTGGATTGTATCCACGGTGATCCACTGGA
TATTCAATGATAGCCTGTCACTGACTCAAAAACGGCTCAGAATCTGAGCACAGATATACTTAAGTATGCCGGATACCAGTGAGCCGGGCTTGAGGTTTGT
TGAAGTAGCCTCTAAACAGTTTGATTACCTTGACCTAGTCACTCCAAAATATTATAATGAGATTTTGGAGGTCCTGTTTAAGTCGGTATGACTGGCTTAA
ACTATACAGACACTAATGGCTGGTGTACAGCTATTGGTGGCTTCCTAATACTAATAAAGTACTCACTTCGTCTTTTGACGCCTACAAGTAACGTCTTCTT
CCTCTCCCTACTTCTTCTCGACCTGTCATACGAGTTATAGGTAATGAGCCCAAGCCAAGCCTCAAGCGACGACTTCCCACGTCTCATCGGCGCCGAGAAT
TTCGACGTCTGGAAGACCCGTGTGTGCGCAGCACTAGATGGCAAGCACCTACTCGGCTACGTAAAGCAGCCCGACTACGACGGTGTGTCGGAAGACGAGA
GTGAAGACAGTGGCAGCGAAATGTCTGATGCCAACGATGAACCGCATGCCAAAACTACCAAGAACGTCGAAATCGACTCCGACGCTGTGGACTACGACGA
GAGCGACGACGAGCTCAAGCCGCCCTCGGACTCGGACGAAGACTCTGGAGCCAGCTCCGATACGTCAATCAAGAGGAGGAACCTCCCGGTAGTTCGACCA
TTTAGCCATCGCGAGGCTCGCCGTGCACGCAAACGCGCCAAGAAAGAGAAGAGCCAGCCTCTAAGCCAGCGCGAACGCCGTCGACAAGAAGCCAAGACCA
AAGCCTTCTTGATGAAAACGATGGACAACATGCACGTGCGGCTCGTCAAGAATCTCACGACATCCTTCGAGATTTTCAGCTACATCTGCCAGAAGTACGA
GGGAGCAGCCTTTCATGGTGATCCGTACTTCATTCAACACTACTTGATGGAGATCAAGTATGAGGGAGGCTCCGACTTAACTGAGTTCTTTCTCAAGCTT
GAGAACGCGATGAAAGCCGCGTCAGAAGCCACCGAATCGGTGATGACCGAGGGACAGAAGTCTATCTATCTGTTCCACTCGATGCCCAAGTCGTGGAAGG
ACGATCTCCGCATCTGGAAGGGCCAGCGGAAGTAAATCCCGTATGAAGACCTCAAGCAGAGCATTGAAGGCAAGGTTCGCGATCTTCAAGCTCAAGAGCG
CTACACCTTGGCCAAGGGCACACCAGAGTCCTCTGCAACCAAGGGTGAGAGAGCTCTAGTGGCTACCGGACCTCCTGTGTCACAAGCCCAAGGCCGTGAC
AGCGCCAATGTCTGTTCCTACTGTGATCGCCCACGCCACAACATTCGCCAATGCCGAGGCCTTCAAAAGGATTTGCGAGATGGACGAGTGAAGGCTGGGA
CAGTGCTACCTGCTAACTTCGCCTTCAAGGGTAACTCGAAACGCGATCACCCGTACCAGAACTCGAACAAAGGTGGCAATGGGCGACACGGCAAGAATAA
TAACAACCGCGACTTCAAGGGCAACAGCAGTAGGAGCAAGAACAAGCACGGAAATGGCGGCAAACAACGCGGTCAAGATCGCTACAAGGACCGCCCGCTT
GAGTCAGACAATGACGATGACGACGACAGTGATTCTGGAAACAACCGCAAGGTAACTCGCCAAGGACGTCGTGACACCGGTCTCATCGCTGTTGCTACCA
CAGTCAATCTCTCGTTTAGCCTCACTGCTCAAGCCAAGATAGAACCCGAGCCCACCTGGACAATCGACTCTGGCTGCACTCGACACGTCACCCATGAGTC
TCAGTGGTTTACCGACATCACCTCCAGTGGTGGATCCATTACGGTTGGTGGTAATAACCAAATCCCCATCGAAGGCATTGGACGGGTTGATCTGGAAGTC
ACTGACTCCAAGGGCACTATGCAGAAGCTTATCCTTCATGGCGTCCTGTATGCTCCCCAGCTCCAATTCAGTTTGCTTTCAATTCCAGCAGCTGTGAAGC
ACGACTTTCGCTTCAACTTTGACCGCAAACAGTGCTCTATGCAAACTGACCAGCGCTTCAAGATCAAAGCGCTCATGGCTACCAACACGGATCTGTATCA
GTTCCAAGCCAAACCAGCGGCACCTCCAGCGGCTCTTATTGCCTCAGGTAAGCAACGTTCCTTTCTGCTCTTACATAAACGCCTTGGACACCCTAACGTT
CGTGTCTTGAATGACCTATCTAGGAGTCAGGCCATACATGGACTCGATGGATCTATACCTCTAGGTCCAAAGACAGATTTCTTTTGTGTTGCCTGCACGT
TAGCGAAGTCACACCGCTCCCCATTTTACTCTAATAGAGTTGTTAAACGTGCTACATCACCTTTGTCAAAAGTCCATTCAGATATCTGTGGTCCACTACC
TGTGCCTAGCCTTACTGGTTGTCGCTACTTCTTGATCTTCATCGATGACTTTTCTCGATTCATGTTCACTTATGCAATTAAGAACCGTAGCGAGTTGTAT
GGCTGTTACGAAGACTTCAGGAAGAAAGCCCTGAATATTTTCAGACAAGATATATCTGTCATAGAGTACGCGTTCAGTGTTGAAGACAATGCAAACCAGG
GTAACTTTGAGATTCAGCGGCTTCAAGCAGACAACGCTAAAGAGTACGAGAAGCTTGGCCGCATCATATTTAAAAAGTATGGAACTCACGCCCAGTTTAC
CAATGCATACACACCTCAGCAAAACGGAGTTGCAGAACGCCGCATGCGTACCATTATGGAGCGTGTCCGAGCCCTTCTACTTGACGGCAAGCTACCGAAG
CAGTTATGGGCCGAGTGTGTCTGTCATGTGACCACTCTCATCAATATGACTCCTAGCTCCAAGACGGATGGACGAACCCCGTATGAGCTTTGGCACAACC
GTATTCCATCCATGCAGTACATCAAAGTATTCGGATGCAGCGAATATGTCCACATCACGGAGCAATACCGAGACAAACTCGACGCTAGAGCCCGTTTGTG
TATGTATCTTGGTGTGCCTGACCATAAGAAAGGATACCGTGTGATGGACATCAATACTCATGCAATTATCTACAGTCGTGATGTAGTCTTTAAAGAGGAC
GAATTTCCCTCTCTCACAGGCCTGACGTCTACTCCAGAGCCCACACAGTCCACGAATCGGCAGAAATCTACCGCTACACTTGCACCTGTACCTCTGCCAC
TTGCAACTGCTACTACAGTAGCACCGGAGCCTGAACATGTGTCAGAACCAGTGATCACACCGTCACCCACATCAGGCCCTGCAATGACAGCAGCGCCAGG
CACAGTGAACCAACGTGTACTGCCCTCACTGAGGGAGGCTGTTGATCGAACAGCCATACATTATTCTTTTCGAACAGAGACGGACTCTGATCCTCCGCAT
CATTCGACTCCTAAGCGACCCCGCCTCTCTGCGGAAGCCATTGATATCTCTGAGGAAGCCAATGACGTAACCCTCAGCTCTGAGGAAGACATACACGAAC
AGGAGCAACGTCAGCATTTACTGTACACATTACTAGCTATTCGGTATGTGTCTGAGCCCACTACGTATCGGGGAGCAATGAAGTCTTCCCACGCTAACCA
GTGGCGTAAAGCAGCTAAATCGGAATACAAGTCCCTCATGGACAATCACACTTGGGTGTTGGTATCCCCTCCTAAAGGAAGGAAGATTTTAAGTAGCCGA
TGGATCTTTGTAGTAAAGTATACCGGCACTGGCGAGATCGACCGCTTTAAAGCGCGTCTTGTGATCAAAGGATTTCTTCAGGAATATGGCATCGACTACA
ACGAGATATTCTCTTCTGTCATCAGGATGGAGGTACTTAGACTACTTCTTACTATTGCAGCTCTTCTCGACTTTGAAGTCCATCAAATGGATGTTAAGAC
AGCATTCCTTAATGGCTACTTGGAAGAGGAGATCTACATGGCTCAACCGGAAGGTTTCAAAATCCCGGGCAAGGAGCACCTAGTGTGTAAACTTCTTAAG
AGCTTATATGAGCTTAAACAAGCGCCTCGTGTATGGTACCAAACCTTGTCTGCCTTCCTAGAGAATCTCGGGCTCCTGAAACTCATTAAAGATCGATGCG
TATTTCGACGCACAGTTGCTGACATCATCTGTTACATTGCAGTGTACGTCGACGACTTACTGATCATTGCGCCTACACCAGCACTCGTCAGTGAGCTGAA
ATCAGCCTTGAAAAAGCGTTTCTCCATGTCAGATTTAGGGGAGGTGAAGTACTTACTCGGCTGGTCAATTCAACGTGACCGTAAAAACCGAACGATGTTT
ATCCACCAGCACAAGTACGCTACGAAGGTCATTGACCGCTTCAGCGACTACATTCCGTACCCTATTGCAACACCAGCAGAACGGAACGCTAAACTTTCCG
TAAGCAGCCAGCCCAGCAGTGAGCAAGAGAAAGATGCGATGAAATCGATTCCGTATCGACAA