Description :
From Genome Similarity Track
Location :
contig_5:3954- 6887
Sequence
2933 bases(100 bases per row)
GTGGCCACGGCACTCCGAGCTGCGTGCACGGCGGCAACATATCAGGAACGTCGGCCACGGGACGCTGAACTTGGTGCCGGGCGGCAACAGCGTGTGCTGG
ACTTTGCGCACATGTTTACGGCGTCCACAGCGCGGGCGCGACGCGAAAGGACTTGGCGCACGACAGCTGCAGCTTGGGATGGACTGGGCGGCCGCAGTCT
CAGCGCGAATGGACTTGGTGAAGGAGGGAACGACGGACACAACGCGGCTGGCGGCGGCTGTCAAGGCCGTGGTGATGCCCAGAACGGCGCAGTTGGCCTA
CCACAGGAACGTCGCGGGCACTGGGCTGCAGTTGGAGCTGACGCTGGCGATGATGGCCGAACAGATCCCGCGGCGATGGCCGTGGGTGCAACGCTGCCAC
TGTGTTATTTGGGACGAGAAACACTTGTTGATAATGCTAAAGACATTGACCATAGTTTATTCGATATATATTCGGTCATGTTGCTCTGAAGGCATTAGCA
TACTTTAATCAAGATAAATACCCTCTTCTTTGCCTACAGAATGCGAATCATTGGAATATCTGTCGCGCAACTCTGCTGTCTTGACTCGCTGAATCTTCGC
TGAGCAACTCTGCACAATCACTACTGAGAAGTAGGTCGGTTTCGTCGACGGAGAGTACAGAACTGTCGCTCTGGGTCTCATAAGAGAGCACGACACTATC
GCTTTCGGGGATAGGGAGAGCTTTATCGACGGGTCTCGCGGCGCTACTTGCCTTCAACTTAGCCAGATGCGATGACCTGTTGACATTTCCATTGTCACTG
AAGAGGCCATTTGGGAGATAGAATCTGTGAAACTTATCCCAACAAGTCCAAGTGCTCTGTGGGCACGTGTACGGACTCTCGATGTATCCATGCACAGTGC
TACAAAGACAAACAGTGTGCGTGAGGCAATAATCCGTCACCTCTGTAGGATATCTGCCCTCGTAGCGACACACAATGCACTGCCGACGTTTCCGCCCACT
GTCCTTGAACATTTGTTTCGAAGACATAGACTGACATCGCTTCAGGGCGCTGTGCGGGTTTGGCGAAGTGTACACTTTAGGAGTTATACCAGTTGCATCC
ACTGCTGCGGTTTCATCAGCAACACCGCTTCCAAACGCCATTTGACCATCGCTCGGGGCTTCTTGCCACCTGCCAGAAATTAGCTCAGATACTAATTCAG
TGACAAACGTCCTGTGGGGATCTCGATCTCTGGAAGTGTCGATTGCCATCCGTCGAGTCAGGTACGCGTTGGACCGTGCAATATCCACTATTGCCAAAGC
CAATTTTTTATGCCATTTTTTGAACGAATGACCATCAGCTAGTGAAAATCTAGCTCGTATCTGATCCAAACGATCAACACCTTGCATGTGTCGATTGTAT
TGCAGGATACAGCTCGGAGCAGGAAACTCATGAGTATTTTTACCAACCCGCCGCGTGACTGTCGCGGCAGTAGATGCATCAGCATTGGTAACCATCATCA
CGGTATTGCCATCGCACCACGACGCAGCGAGCAAGTTGTGCTCCAGGGAGACAGACTGCTGATAGTCACCCCTTGTTGAGTGCTCCTTCTGGAGAATAGT
GTGCTTCGGATAGTGCTTACTCCTTCCCCGAACAGTTCCCCGCCCATACAACCCCTTCAAACGCAAATCCAACAGCAACTGGACGCTTGTGTAATAGTTG
TCCATATTGATGATTCGTCGAGAGTAAAAGTAGGGCCTCACGACCTCTAGAACATGCTTACGCACTTGTTTGACATCCTCGAGCTCCTCACGAAGCTGCT
GCACCTCTTCTAGGCTCACCACGTTTTGCAGGCGGTCCGCGATATCACTATTATTGCAGTGGAGGCGATAGTTCAAAGCGATCCACGTGGTCGAGCAGCA
CAGCACGTACATACGAAAATGATACTTGCCGCCAGGTTTTGGGGATTGAACACGATAAGATGTCGTCCATGGCGGGACCGGCATGCGATACTCGCTTCGT
CAAGAGCCAAGTCACGGCCAGGCTCAACATAGCGACCACCAGTGCATTTGAGCAAATTCAATAGGGGCCTAATTCGGGCTGCTGGGTCTCGTTCCACAGC
CGATCCCGGATCAGCGCGAAAGCTCAAACAGCGGCGAAGCAACTTGAATCTATTTAGACTCATCACATTGTCCAAGCTGGTAGATGCACCACCAAAAATC
GCATCTTCAGTCTGTGGCCCCCAGTAGTTAGAGTACTCCCCCTTGTCAGTGAGGGTCAGATAAAGCATGATGCCGAGGAAGATCATCAGCTCTTCCATTG
TAAACGGCGTGGTGATTCGAACATTCTTGAGGGCTGCATATCGATTCGTCTCGAGAACCACTTGTTTCCAGAAGTAAATTGGAATGTAAGCGAAGAAGCT
CGAAGAGGCTGAGTGTGCAAACAGGTGACTGTACTCGGGTAGTAAGCGTGTACTAGTGCTCTCGTCCGTGTGTTCATACAGATCCGTGGGGCCATCCATA
TCCACATCTGGCTGAAACCGCATACTTTCACCGCTTCCACCTCCGCAAGGCTCACGGGCAAAAATCGCTCTGGATCGTACATTTCCATACCGTCGTCGTC
TGACGCGACTTCAAGTTCATCGAGCGGTTCCTCCATCTGCAGCTCCCCTTCCACCACTGTATCAGTCAATTCACGCCACGCCGGCTTGTTGGGTGAGCGC
GCGAGAGCCTGGTAGTTCTCGATCCCGCGCTGAATTACTGCCACACTCAGAGTTTCAACTGCATTCTGGAACTGCGTATCTAGCCAAATCACTTGTAGTA
CCCCTCCCTTCTTCGTCTTTTTGACCTGACGACACACACGGCCGACAATAAAGGCTGTGCCCACGCATCTATACACCTTTTCCTTCATCCACAATTCCTT
TGACGGTGAAAATGCCACCAGCTTCTTTAGGAA