Description :
From Genome Similarity Track
Location :
Scaffold_507:3954- 5018
Transcript NameFunction/comments
Phypl_g8986hypothetical protein

Sequence
1064 bases(100 bases per row)
GGTTGATGTCTGCCACAAAATCAATCCAAAAGTTATGTTCCAGAAGTTCCAGACGCGAAGGGATGGCACGCACAATAATATCATTCGTGTCGAGGTGATA
TGGTCTGAAGAACGACCCACTACCACCGACCACAAGCACCAAATTTTCATGACTGGCAGCTTGCATAGCAACTAAGttcgatgatgaagacgaactTGAC
TGGGAAATCAGGACGTCGAAGTAGCCGAGTGAAAAATCGGAGCTAAAGCCAATCTTCAGTTGTGTCCCATGCACCCGAAAGTTCATATCGCGGAAAAAGC
GACCACCATAGTGAACAATATACTTCGAGAGCTTCGCAACGCGATACAACTGACGTCGTCGAATGAAAAGCGTACTTATAGGGGGCATAGTGACAAATAA
GAAGCGATACAACCACGTTTCCCAGCCTGCAGGGTCCCACTCCACCAACTTGTTGCATGTCGAGGCAAAACTCGCATATGTGCCTTCCTCGACGATGTCG
CGCAGACTCGCGGGCAAGAAGTACGGATTTAGTCGCCAGGCGTTCTGAGGGTGGTTGTCTCCGGCAAGATAAAGACGAGCAACGTGGGCATTAAGATCTT
GGTCGGTTAGCCGAGGGGTTAAGGTGCGCGTCAACGTCTCCAACGATAGCTCGTCACGCAGTCTTTGTGCTTTGTACTGCGCATAGCGACGTAACTCAAA
TCTGGAGCTTCGATAGGAGATGAATCCCCAAACACCAAAGATAAGACCGGTGACAGCAAACACGATAATCACAAAGCCTATCGGACCACCGATAGGTTTC
ACCAAACGCTCGAACGGTGTCAGGCAGTCGAGACCATTGCGGCCCTTGAAACAGGCGTATGAACAGTTGCCACGCAGATTGAACTCCGAGTGAACGGGCT
TATTCTTGCAGGCAGCACAAACAGTAGCACCAGCTTTTGCGGTGGTCCTCCCGATTCCACATACGgtgcagttgctgttgccGGACGAAGTAGTAATGCT
ACCAATAGGACATGAGGAACACGCACTGCTACCTGTCACGCCTGCAAATGAGCCGGGTGGGCAC