Description :
From Genome Similarity Track
Location :
Scaffold_175:39531- 41045
Transcript NameFunction/comments
Physo_144269hypothetical protein

Sequence
1514 bases(100 bases per row)
CTAAGAAGGCCTAGGACTCGTGCTCTGCCATGTAGTTGTAGTAGATCTGGTTCTCGTACTCGGTGCTGCAGTAGGGGAACTCGGTATCACTGTCGGTCGG
CGAGAACAGCGCCTTGCCGGTAGTATACGTGACATAGCAACCCAGCAAGAAGCACACCACGAGCACAATTACGCCGGCGGCCTTCTCGTACCACGGAGTA
CTTCCCCACGCCTTCATTAGGTAGAAGGCGATCGGTAGCAGGATGCAGTTTACCGTGATGCACGACGCGCCGACGAAATCGGCGAAATCCGAAAAGTGAT
CTTGGAAGATAATGGAAAGCACGACGAGGATGACGATAATGACAATACGCAGCGTAATGTAGTTGAGGGTGTTCTTGCCACCACGGTACTCTGCCGCTTC
AGCCTCCGGGTCGTCCTTGAAGTCACGCTCACTATCCGCCACGGATACATAGGACATCTTGGAGCTGCGGCGAGACTCGGTCTGGAGGATGGCAGGCGTC
GCGGACTCGGCATAACCGACGCCAGCTTCCATGTCTGTCTTCTTGTGCATGCCCAGCGCCATACGCTCGGCAAGGTAGAAGGCCGGGTCGATGAGCACGG
AGAAGGCAATGGTAATGTGGAGCTGCATGAACAGGTATGCTAGCACCACAGCGCCCCAGCTCGGTGCGAAGCCCAGGGTGGTCATTCCGGTGTCCGCGTC
CGGGTAAATGGTGAAGAGCAAGTTGCCCGAAATCTGGCAGCCCACAGCTGAGTAAGCAGTGCTGGCCAGCACGAGGAACAGGCACGAGATGAAGCTCACG
GTAACCAAAATGACGCGAGGCATGCGAGTCGGGTCGCTGTTCTGGCGCTGCAGGTCCGGGATGACAATACCAGCTCCGTAGGCCAGAGCCAAGTTGCCGA
AGCAACCCAGAACTTGGGAGACCTTGAGGTCCGGGGACGGCACTGAAGGGTGGCCGCGCATGCCATGCATGACAACGGCCACGCCGATCACGTCAGCGAT
AATGGTGCCCATGCAGCCGGCAAAGGCGGCGCCAGCTCCCTCCTTGAGAGTGGGGACCAGGCACACGGGCAACACCATGAGCGCCATGAGGATGATCCAC
ACGGTGGCGCTGAAGGCTTCAGGGAAGAGTCCGTCGAGCAGCGAGCCGCCCAGCACCAGGAAGACGCAGGGGATGAGTAGACACGAGCCCATTTGCGAGA
TGACGCAGAGCCAACGACCAGTTTGGCCCATGCTCCACTCTCCGAGATCCCCGAACGTCTTGACAGACTTGGGGGCGAGCAGGATCACGCGAGACATCTT
GACAGACGCGTAGATGTTGGCGAATGCCATGAAGGCCATGGCGATGACGGCGAGCACAGGTCCGGCGCGCGAGAAATTGCCAGGCATCCCGAGGGTGCCG
ATGCCGTACATGCAGCAGAAGAGGTTGAAGGACGTCTTGGCGTCCTCCATCGTGAAGAACGGCATCTTGGACGGCGGGGAAGTCGACTTGAGCCGGGACC
AATTGGCCGAGAGC