Description :
From Genome Similarity Track
Location :
Scaffold_205:39530- 50349
Transcript NameFunction/comments
Phyta_totarag5565hypothetical protein
Phyta_totarag5566hypothetical protein PHYSODRAFT_307605
Phyta_totarag5567hypothetical protein
Phyta_totarag5568hypothetical protein
Phyta_totarag5569conserved hypothetical protein

Sequence
10819 bases(100 bases per row)
GTGTGTGCTGTGTCTTTTTTTACTGCAGTTCTTTGCCGAGGTGCACCGATTGTATGTGAACGCCATGTCGAACCCTTTTGCACCGCTGGGAGAGCGTCTC
ACGTCGCAGACATTCGATAAGCGAGTGTCTaatctcgtcgtccagcacaacACAGGCAGCTAAGATGGAATGAGGTTTTCTTTGCTTTGTGCAGTGTATG
CTTTTACTTTCCTGACAGCCGCGGTCTTCCTCTACATACTCAAAGCTTCGACTGACAGGTCGCCCACGCCGCTGTCGTactccttctcttcttcctctga
aTCGGACTCCTCCTCACCTTGGTCCTCTTCGTCAATTTCAGGCATGGGGAAACGCAGGATGGCAGCGATACCGCTCACTTGGCCTAGCTTGTCACCTGAA
ACGTGCAGACTACTGAACAGCCGCACAGTGCCACCGTTGTCCCGCACGCTTTCAACCAGGTCGACGTACTTGCGACGTGTGGCAATATCCTGCGACTGGA
AGAGAGCGTCCGTGATCATGAGCGTCTCGATGGCCATGTTCGCGTTGGCACGCACAACGTGCTTGTAGCCGTAGTACGCGCGGTCCTGGTCGATGTGCAG
CATGTTGAAGAAGCGCTCCAGACACTTGACGTCTTCCACGGCCTTCGTATCCGCCACCTGCGACTGAATTGCTGGATCAGTGAAAACTTCGTCAAGTGCA
TGCTTGTGACCGGACGACGAATGACACAACACAAACTTGGGCTTGTTCTCGAGGATGAGCTTGTCGTCCTGGCGGACAGCCTGCTCAATCATGAACTTGA
AAAAGTCGTCTTTGACGAAACCCGGACTAGCAAGCAACACGcacttgacgagcttgaAGTCAATATGCTGCCGAATGGAACGCACGATGTTCTCGTAAAA
CTTCTCAGTGCCCTTGGCGTGAGCAGAGCTTCCCGGACGCTTCTTGGGTACACTCGTCTCGATCCTGGCGCGAATGACAGTCATATCACCCTTAATCAAG
CACAAGTGTGCAAGACCGACCTGCATGACCACAGCTGCAAGCTCAGCTTGCTTGGTGATATCGCATGCCATATCAATACGTTCCAGTGACATGACGTCCC
AGCAGTTCTTTgtcagcgtgaagtcgcGGTTCATCTCGAGATCCAGCGTGTGGTAAGCTCCCATCTGCACGCACAAACCCGTGAGTGAATCTACCCCACA
ACTCCCCTCCCCTTCACATGCATACAGTGTCATTCCCAGTTATGTACCCGAACGTATTGACTCTCCATGACGTTCTTGCCCTTGATACGCAGCACGCACA
GTGCTGGATCGAAGTTCACTTGCTCCACCTACACATCGTCCAATTTTTAGCATTTCAGTAACTCAACGCAGCATTTCCCAGCACAGACACCACCGCACCT
CAATTTTCAGCGTCATGCGCACACGTTGGCTACTGGTAGAGCCCGTCACACCTTCCTTCACCACCTGCAGACACCATAACGAGGTAAATATTCACTTAAG
TACGAGTTGAGTTGGCATTGACACAACTCGGCGCAGCGGCCGCGTACCTTGCGGATCGTCGTGGTCTTGACCGAGTCAGATACGTGGATGAGGTTGTAGA
TGTGCCACATGTCCTCGGGTTCCTCGGcgcgcagcaccaccgaTCCGGCGCCATCCTTCTCGctgatctgcttcttgagcagcttcatcttaGACCTCCG
ACGCAAAAATGGCTCGGACAAACCAAAGGTTAGCTGAATGTAGCTCGATATTCGCGCGACATTTTTAAGACGACTTCAATTTGccgacatggctacactt
gtGCCTACGGCTGATGTGGTGGCGGGGCTTGTCCCGCGCGAGATCGATCAATGGCTTCCGAGACATCGATGCCGCGCGACTCACAGACCCCGAGGCCAAT
GGCGGACCAGTCAAGGTCACTGCGGCCTTTGGCGCGCTCGCTCAGGAAGCGGTCGATGAGCGTGGACAGAAACGGCATCGGCACTTGACATTCCAAGGCC
AACTGGTGGGCTAGACGCTGATCCTTATagcccagctccagcgcaaAGCCTCCGGGGCGATGATCGCGCTCGGACACGCGCTGTCCGTACCCTTTGTGGA
TCACCGAGTTcatgaacgtgctgctgtagaACTGCATCGCCTGGACGCGGTCCACACCGTTGGCTTCCAGTAGGGACAGTGCTTCGGCCATCGACTCGAT
AGCCGTCGCGATGAGGAAATTCCCGCACAGCTTCACTGCATTTGCAGCGCCAGGATCTTCCGTGCTGAATGGAGCAACTCGTCCGTTCGTGCACTTGTGC
AGCCATTGAGACGCCTGCTCCACGGCAGTGGCGTCGGAGCCCGACACCACGAAGTTCGCTTGCATGGCCTCCATGCCGTCCGGACGTGCAAAGATCGGAG
CTGCAACATACTTCGTCTTCGCTCCACAATGCGCGGCATCGAGAGAACGTGACGTGCTCGGGTGGATCGTGGAGCAGCCGACGTGCAGCGCTCCGGCAGC
CATGTTGGCCAGCAGACCCAATCCAGGCTTTGCGTCATCTCCGAGCACAACGCTCGTGACGACTTCGTCCTTGGGCAGCACCGAGAAGATCGTGTTCGTC
TGGGCAGCCACCTGCTCGACAGAAGAGGCTGGTTTCGCTCcgagcagcgccagacgATCGACATTGGCGCGGTTGGCGTCGAAGCACAGCACGTCGACTC
CTGCCTTCAGCAGATTGTGCGCCATGGGGAAACCCATATTGCCCAGACCGATGAAGCCGACGGGAGATGTCGCTGAACCGGAAGCTGCATGTAGCACACA
GAACAACGCTTAGCTCACAGAGATGATGATTCGACATGTATTACTCGATATTAACCAGAGAAGTTCCGGCGCCCGATAGAGCCAATGTGACGGTAGTTAG
CTTGACGCAACAGCATGTTGGACTGCTATTGACCTGAAGCTCAGCAATTGGGGAATGAATGTCAATCAACTGCCACGAAAAACTTGCAAGCATCGGATAC
CTAACAGGTCCACTTCAATCTCATCTTCACATTCACCCCTACATTTCGTCACATCAAATCCTCCAAATGATTGCAGCTTATGTCACTCTTCTGCGGGATT
TTATTTTTTCACCGGAGGGATGACTCGGGGCAAGGCGACATCTAATTTAGCAGGCATTTTCACCTTGGCGTGGCATTTCCACTTACCGTGCGTACCGGTT
TTTCTGTGTGTGTCATCATGGTGAAGCGTGTGCCAGCGACCGCCAGTGCGGAATTCCTGCAAGCTTTGTCCGCGTCGGCCGCTTCGTCCACACCGTCGAC
TCCTGCCGGCCACGGGGCCAATGGTCCCGCCAGCGTCTCGGCCGTGTGGTCGTACTTCGAGAAGGACCAGTCGGGCAACTCCATCTGCAAGTTCTGCGAG
CGCGTGATCAAGGGCCACCATTCGTCGAACCTGCTGTCACACCTGCGCACGGCCGGACGCACGGACGCCATCCACCAGCAGGCCAACAACGTGTGTGAGG
AGCACCGCGAGACCAAGCGTCACTTAAAGCGCCAGAAGCTCGGGCTGCATGCCGGCCAAGCGGGCGCCGAGTTCGTGGCCGCGGCCATGTACCCGCCGCC
CGGCGCCTCGCAAGCTCTGGCCGCCGCTGTGGCAGCTGCCGGGGGTTCGCCCGGGATGTTCTCGGCTGCGTTGAAGAGAGACCCGACGGCTGCTTTCTAC
ACGTACCCGCCGCCAGCTCTGAACGTGTCGGGGATGACCATGACGAAGGAACAACGGGACGCTCTGGGCTCTGCCTACGGGGTGCCACCAGTGCAGATGA
ACGCGGAACAGTTCACTCAAGACTTGGCTCTCATGGCGTTGATGGACAACCTACCGCTCAACTTTGCCACGAAGCCAGGGATGCAGTACGTCATGAACCA
GTTGCTCGgagagaagaagctgccgctgccaggtgaagaagcgctGGCCAAAAGTATCATGTTACTGCAGGAGAGTGTGTTCCTGACGACCaagatggtg
ctggccaGAGCCAAGAGTGTCGCGGTGTCGCTAGAGCTCTGGCAACACCCGTCTCCGATGACGAACCCCAAGCCGACGCTGTATCTGGCTGTGAAGATTC
ACTTTAGTGTGAACTTCCGGCTCTTCGATATTGCGATTGGAGTTGTGCcgctggaggaagagacTGAACTAGGCACGATCAAGGCCATTCTCGATTCGTG
CCTGGAACGACTGGGCATCAAGGATAAGGTCATCGCCTGTATCAAGGATGAACTCCCGACGAAAGTCGAGCTCACGGCTGCTGACCTTCCGTCGCTGTTC
GTGCCTATTAATTTGGACGGTCGACTTGTATCGCCTGATGCAGCGCAGAGCACGCACCTTCTCACGTCAGCGGTGCAGCACCTACGTGTCTGCTTGACCC
AGGAAGTATTCGCTAAGGCGTTCCCGGAAGTGGTGAGTCAGGTTGAGGAATTCGTGGCTCGGCTGGCAGAGAATGAGGAGGCGATGCTTTCACTTAGCCG
TAAATGCCCGCTTTTTGACGTCGAGCTCTCCCCAGAAGGACACGAGACAAAGTCCTACTACGAGTTCCTTCGCGACTTTCTTGAGCACTTACccacgctg
gagcagattGCAAACGCAAACCTGGTGGCGTACCTACCCGCATCGACTGTGGAATTTATTGGCTTGGTAGTGAAGAAATTGCGGCCATTTTCCCGGTACT
CAGAGGCTCTCGAAGGAGAAAAGAACAAGAAAACGGGCAGCGACAAGGAGGTGAACAAGAACGGTATGTCAAGCATTTCAACTATCGCCGCGGCTTTGGT
GACATATGCAGAAAAACAAGCACTATCGGCAGCTGAGGGCGTGCCTACCCACTTGGGACCAGCCACGTGGAAACGCTTTTTCGAGACGTTATCGAGGAAG
TTGCGTGATCAGTTTGCAACGCTGCCACCAATCTGCTACGCAGCGACGCTTTTCGACCCACGCTACAAGAATCGTGAATATTGTTATCTCTCTCCCAAGG
CTGAGTGCGATGTTGGCAAGGGCTTCCTCCGTCAGATGTTTACGCCTGAAGGTGACTCACTGCAGTTATCGAATGCCTCGGGTTCCACAAGGCTACCGGA
TTCTGGTGCGGACTCCGTCGGTAGGATGGCAGCGTCTGCCTATGTAGAGCTGACTAAGGAGCAGGCTAGCCCAACGGGCAACGATGTGGCACTcgctgac
gatgaagatgacgaccTGCTTTCTCACCTGccgtccgagtcgtcgaagtcgtctCTCCAGGGCGAGAATGAGATGGTCGCGACGTGGGAGAAGGAACTGA
GTGCATTCCTGAGTCTTCCGGTTTCAGAGCGCAACGTGGACCCATTGGCATGGTGGAAAACGAACCAGCTCCGCTTCCCGCTGATTGCACCTTACGCTGA
AATGGTGCTGTCGTTAcccgcagcttcttcaagtgGAGAGACTGTCCGAAACAACGTGTACAGTGTGCTTCTTCGCACAGAAGGGCTTGGACGCGAGGCG
TCACTGGCCGATAACGCGGCCATGGTAGAGGCTTACCTGTGCTTCCAGAAGAACAAAGAATACGCTCTAGAGTGGTTTCGGTCGGGATCCAGCGCCAACG
GCATGGTAGAGGCTGCGGGGCTGAATGCTGACTTGGAAACCAGTgctggcagcttcaagcacatCGAGAACGTGTGATGAAAGGGGTCGTAAATCACAGT
GGACTCGAGGTATATATTGGTCACGCGTCACAAGAAGCAAGAAGCAAGAATACAATGAAAGCACCAGTCGAGGCTAGCTCAAGGAACAACATGTTTAACG
TCTCATATCCATCTGGGCTTGCGAGATCACGCGAGTTGACTCATCGACGAATGAAATATGATTGTctgctgttgaagtgctcTGATGGACAGTTATCTTG
TTTGCATCTACCATGCAAATATCGTCGCATCCGAATCCAAGAATGCAACCAATCCACAACCTTGACAATGGCCATATATTTACATCGGCCAATCCGATCG
ATGCGCGGCTTGAGACACAGTAAACAGCGGCATGCCTGCACCACGGGGTTACGGATAATGACCCCGCACGCGTCCCGGCGCCATGTGGCAACGCACCAAA
CTGCTTTGACAgagcagtcgcagcagtaAGCGGAATTGTCAGCTATTATTGCAGTCCACCGTTCCCATATAATTTGTTTTCATCACTCGGTTGAGCTTGA
AGGACGCGGTCACGACTTGAGTGGTGTTGAGTGGTGTTGGTTGCTTTGCGGCGTCATACGGTGAATACCAACAAGTACCATCCACCAAATATGATTATCA
AAGCCATTCACTTCAACATAAAGTATCGTATGGATTTTACTCCTCGTGCGCACCGCACCCTAGTGTTAACTCTGGTAGCCGTTTCATCCAAAACACCAAC
CGAAAAGTTGTTTATTGTCCGCTACCCACAAAAAACAATTGGAACGCTCTATTGAGCGAAAACTTCGCTTCACGCAGCCCACACCAGCCCCCTGCACATC
TTAACTCTTTCGTTATCGCCATACTTATAGCCCTGAGTCTAGGACGTTTGCCGTGTTCGTGTAGCTGACACAAACTCTTCACCGTGGGCATTGGTTACTT
CTGCATGCCGCAGGAATGCCCCAAGCGCCCCAAGGTAACCTTCGTGCTTACAAAAGCGCGCCTCCATCGCTCCGTTCGACCAGAAATTAATTGCGTACGC
TAGCGTCCTTGATGAAATCTTGTTGTGCCGAAGGAAGTTTCCAATGAAGAAAATGTTCTTGGTCTTATACAAGGTCGCGTTCAGAAAGGCGACCTGGCCA
ATATTTTGTGTGATCATAACCAACAGTGATCGAGCAAGATCGGCGTCACTCACACTTTCGCGAGAAACCGAGATCATTTTACCGAAACTGCTGGCAACTG
CTGACGCCGGTAAATTGAATTTGTCGTACGCTCCGCCATAGATATCCCCCACACTCATATCAACCGATTTGTTGGAGCCATGGACACACAAATCCAACGC
TTCGTCATACGATTCGCAGTGAGTCAGCAGTCGACAAAGGCCCCAATAAGTGCCCccaccaatgctgctgccgcttACACGTTCATAATCCCCAGGCCCC
TTTACATACAGTACACTAACACCGGAACCAATACTGACAAGCTGCGCAGTGAGCAAGGGCAGTCAACGCAGTTAGTTGAGTTCGCACAACCTTTATGGAA
ATTCGAAATACTTCCTAAAACGCACCAGATACGGATAAACATTTTCGTCTGCATCCGATTGGATGGTTTTCACTCGCGAGGCCGCTAGAGAATTAAAATC
GACGACCTGTAGGGCGACAGATTCAACAATTCAGCCTCATACCCCCACAAACAGCACACAAGAGCTCCATGCATACCTCGAAAGTGTACATTTCGTCAGA
TAGTGTCGTGAGCAGGAGATGCAGTCCCAGAATGGTGCagttgatctcgtcgtacttctccagctcaatCCCAGCAATCTCGTTGAACGCATGCCCATAC
TGCGACCAAAACCAACAAGTAAATTCACGCATGTCAGCACTTTTCCACCCACCacttaaaaaaaatcaattGCAATTTCGGACCTTgtgagcaccaccac
ccgTGCAGGGCAAGATCCTCAGCGACTGGTTGATCCCGTTGTTCACAATAAACTCGACCGCTTCTCGAGTCTTGTTGCTTTCAAACCGCACGAAGTGAAA
GACCTGCAAAACATCAACAAGTTAAAGTTAAGATTAGCCCCCCCAGCACTATCTCTCCATGACAGAGTACCGCAACGTACCCCGTTGAGTGTCTTGGAGT
ATGTCCTCAGCCGCACGTCCTGCACCCCCGTGCTGCCGAACGACTGGTGCTCGCGCAGGAACTTGTTCATCTCTCCAgccgccacgtccagcgacgccga
gcgcGGCCGCTTACGCTTGTCATTGCCAgcctcgtggcgctcgaAGTACACGATCTTAGCCAGTGTCCCCCCTGcaccatcaccagcatcatcatcagca
gcagcaggcagagCACACACGCTCCGTTCAGTCCGGAGCCAAATCAGAAAGTTGCAATGGATTTTTTCACTCGCGCACCGATGTCCAAGCCGAACGATGC
CCCCAGATCGGATCTGCGAGGCGGCAATGGTAGAATAAGAGGCGGGAGTTAGTGAGGGAATTTGATGAAAATATCCGAGATTTTCGCAcgacttcgacag
cttcttgtagGTCAGTCGCTGACGCCACACgcgctggcggtggcgcttACGCTCCAGACAGAACAGCACGACGGTCGAGGAAAAGAGTAGGAAGCTGccg
gccagcagcgtccgcTCTGTGCCGCCGCCGTCCGCCACCATGAGCATTAACGAGATTGAACCTAGTGGACCGCTCCCCGTTTTATCGACCTATGCGCGGT
TGGATTGGCTAAAAAGAATGCAAATATgattttcagccaatggATGGGTATCAATGTTCACATGCGCAGCGGTTTTTCGATGACGCAGCACACTTCAACT
GGTGAATGGAtctgctgcgctgcgtccAGTGCTCCACTAGCTCTATACACCGAGTTGAgagttacatgtattagcTAGGAATTGGCCAGCTGAGCTCTAT
GGTCTATCCGGTATTCACTCTGCGGTCTGTGATCTGCTTCGGAGCTGCAACTGAAAAGGTTCATCCGCCAGATCCCCATCGCTCCTCCGGATAGGAATCA
ACCGATGATTCAAGCTGAGCAAGGGCTTGCAACCATCTGACACCGAAGTCACACGCGCCCAGCAGTTTCCCCTCTGCTGGCACCGTGCCCCGATCCGATC
TGTCAGAGCTCCCCATGAAGTTCATGGACCCATGATGGAAATTATTGAACCCACACTTGTTGTTGTCCGTCGACGTGTCGTCGACAGGCAAGTGATGGCA
GTGATCACTGCAATCACTGCAACGCGCCAATCCACGAgacaccaacagcaaaatCCGGGAACGCGAAAGCTGCGATAATAATCCAGATGTCCCTGACAGA
TCCATTTTGCTCGAATTTGACTTGGAATCTGTATGATGCCGCGAAACCAAAATTCGACTCTTTTTTACCGATATTTTAGAACCAGATGACGCGCCGGCGG
AGTGATGGTCCAAACGTGCGATCTTACATTTACCCCCAATACATTATGTATATATTTTGACAGTACAATACAAACGACACTGGTATCTACCTCTATCTCG
CAGTGTAGGTAACCAAAAAAGAATCCACTAACTCCTGATTGATACCTAGTGTCACGCCCGTTGtcgcgtcgtcgttggcgaGGTGAGTGGGCAAATCTCA
TTCCTTGAAGCGCTGGTAACAGCCGTAGGACTTCGGGTCGACTCGGCAGTGCCAACTCAGCGCTGCCGACCAGGAATCCTGCCATTCCGCTATTTGCAGT
CAAGTAATCACGAGTAAATTCCACCGAGAGCCatgcactgcagcagcagcaacaagtcgcCGCCGACGCGCCGCATAGTGCGTCGACCGCTGCAGTTCAC
TTCACCTgccaaggagcagcagtaccgCGCCGAGATGGACCATGTGCAGCAGTACATCTGCGCACAGGTCGGCGGGCTTGACGAGGCCTCCAGTCAGCTG
CTCGGCGTGCACGACAGTCGCTCGCGCAGCTACTACGAGGAGATCCAGGAGTTCCTCGAGCGCAAGCaccagctcgagcagcagcagcaggagcaggaga
caGTGCAGCAGAGCACCGAGCGCGTGCTCATCCAGGGCCTCGACGAGTACCTGAACGAGCTGGACCCGAGCTTGTTCGTCGAGTCTGCGCCAGCCACCCC
TAAGAGCCTCGTGGTCGCCAACCTGCCGGTGCACAGCAGCTACATCCGCCGGAAACAGGAGGAGGCCATGATGGCCCGCTTGCGGACCAAGTATCAGGCC
GCGGAGGCCGAGCGCTGCACGATGCCCTCGATCTCGTGCGGCGGCCCCCTCAAGCGCCAGCGGGTCATGTGAAGGACAGCAGACCTCATAGAATATCTCT
AGAGACAAGGGAGCACCTGGAGCGGGTGATTACGAACGCCAGCGAGCCATCGAACCCCTCGGTACAATAGTAAACTAAGTAATTTATCGCCCATGAGGCG
TTGTTTCTGCCGTAAACGTTTCTTCGTGCTCGACAAATAGGATCGCCAGCGGCCATCTGGAGCCTTGGCGTCAACAGAGTATCCAGCATAGAGTCAAGGA
TCCGAAGacgcagtacatgtacccgcAATGGAGATCGGATACGTGCGGGTCTCTGCCAATGGCATCGAACATGCATGCAGCAAGGGTCGAGATTCACTTC
AAGATCAATGGCAAGAAGTCGCGTGAGATACCCGCATCGTCTTGGCCAAAGCTGTAGCGAGGAAGCTTCGAAACGAAGCTCATTGTGTCGGACGCGATTT
GCTTGCGATGATGCTTCGCTGATTATGAGTGTTGAAGCTCACTTGATGCCacgcggagctgcagcaacgcctgGATATTCTTGACTGGTCCGTGTGCCAT
TATTCAGGACGGTCATTTGTAGTACGGCTGCATTCTGAGCAATATGCGTAGATGAACATGTACTTGCACTTGCGGGGCAATGCACCGGGTGCATCTGCCA
TGGTCTACCCTGCCTTGACTTTCAGAGACAGCGCTCAAGTTGAGACCCCAACTGGTGTGTTTTACTTAACTACGGAAatactcgaagtttccgcgcatGG
CttattgaatcgacaggatgaaaccgccgaacaaatcggCCAAATCGGCcaaatcacttcaattgactagGAACTATTcataagtacgaaatcggactta
agtgaaattccgAGAACAT