Description :
From Genome Similarity Track
Location :
Scaffold_39:395282- 403599
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G011937Similar to NEFM: Neurofilament medium polypeptide (Bos taurus)
Pytul_DAOMBR144PYU1_G011936Similar to ddx20: Probable ATP-dependent RNA helicase ddx20 (Dictyostelium discoideum)
Pytul_DAOMBR144PYU1_G011935Protein of unknown function
Pytul_DAOMBR144PYU1_G011934Similar to lev-11: Tropomyosin isoforms c/e (Caenorhabditis elegans)
Pytul_DAOMBR144PYU1_G011933Similar to At2g30105: LRR repeats and ubiquitin-like domain-containing protein At2g30105 (Arabidopsis thaliana)

Sequence
8317 bases(100 bases per row)
CCAAGGACGAAACGAAGTCTGATGCAAAGCCAGCTTTTGTGTTTGGATCGTCTTCAAGCTCTGCGTCAACTGAAAAGCCTACTTCTGGATTCGGTCAAGA
TGCGAAGCCTGCCTTTAGCTTCGGACAGAGTAGTAGCGAAGCAGCTGCGAAAGCGTCTCCGGCTGCACCTACTTTCGGTGCAAGTGCTACTCCAGCCTTT
GGTTCAACTGCACCCGTGACCGCGCCTGCCTTCGGTGCTTCTCCAGCAGCACCTGCATCGTCCACGCCATTTGGAAGTACTGCAGCTTCTACCGGACCTT
CGTTTGCGTTTGGAGCGATATCGTCGTCAACTGCAGCTCCACCGACAACAACGCCTGCTGTGACATCGAAACCAGCGTTTACGTTTGGGCAGTCATCTGG
AGCGCAATCCACGACACCCACAGCTCCTGCTGCTTCATCTGGCTTTAGTGCATCGACCTCGTTTGGTCAAACTCCAACGTCGGCATCAACTTCGTCCGGT
TTTGGCTCGTCCGCACAGCCTGCTACTTCGAGCGCTGGAGCAGCATTCAGTTTCGGGTCTTCGACTCAAGCTGCAACTCCAAGTCAAAGCACTTTTAGCT
TCGGCGCATCAGCACCAGCTACTTCTGGCTTTGGATCCACTGCGCCTGCGCCATCTGGCTTCGGAGCAGCAGCACCAGCATCTAGCTTTGGCGCACCAGC
TCCAGCTTCCTCCGGATTTGGCTCATCGATACCAGCATCGTCTGGCTTTGGAGCATCTGCGCCAGCTGCTTCCGGTTTTGGATCGTCTACGCCATCTACG
ACTTTTGGTGCACCAGCTTCGTCAGGTTTTGGGGTGCCAGCAACGACACCGTCTGCATTCGGTTCTGCTGCTCCGGCCTCTTCTGGCTTTGGTGCGTCTG
CTCCAACTTCGACTGGTTTTGGAGCCCCAGTGACGCCGTCCACAACCACCTTTGGATCGGGTGCTGGTGCCTTCGGCTCAGCCTCTGCAACAGCGTTTGG
TGCGTCCAACCCAGCTGCAGGCAGCGCGTTTGGCGCTCAAAGTTCTCAGCCATCGTCTTTTGGTAGCACCCCTGGTTTCGGCTCGTCGGGTTTTGGAGCT
CCAGCCGCCACAACGACGTTTGGCGCACCAGCTGCAAGCGCTGCTCAAGGTTTTGGATCGTCGGCGTCAGGCTTTGGCGCCCCTGCCCAATCCTCTGGAT
TTGGTGCTCCGGCTGCGTCGTCAGGTTTTGGTGCTCCGTCGTCGGGCTTTGGTGCTCCAGCACCTGCTTTTGGCGCTCCAGCTCCGTCGTCAGGTTTCGG
TAATCCCAGTCCAACGTTTGGTGCTCCTGCTGCTCCTGCATTTGGCGCACCAGTCCCAGTTTCGTTTGCTCCTCCAGCTGGTGGATTCGGTGCACCGGGC
GGGTTCGGAGGTCAACAAGACGGAGGCTTTTCTGTTGGTGCCGCCCCTCCACAGGCTCCAAAAGGCCGACGAATTTTGAAAGCTCGCTCGAAACGCGCAT
CATAGAGATACAACAATGGGACAGTCTTTGGGCTAATCAACCTGACGTAGCAGAGAAGAGACGAACATGAAGTGAAGCACCCGAGCGGACAAGTTTGCAA
GAAGAGTCGTCGTCTCACACACTCGCGCGTCGATCCGTATCATGGAGCTCGTCTTTTGTGTCTTCGGGACGGATGCACCAAAGCCTCTCGTGCTTTCGGT
GGGTTTGGATAGTAAGTATATTTAAAAAATCAATGCATTTCTTCAGAACGTGGCAACCGAATGAGTAGGGCACTCGCATGTGGCACCGCTGCCGCCCCCG
AAGAAGGAAAGACCGCCGATCGGCTCGCGTCGTGGTGCGGACTCAATGGGGAAAGAAGAGAGTAGTTTGTCAGTATAAACGTGTGAATTATCAATAATAA
GCAGGTTTATATTAGATTTCTCAGCAATAGAAAGGATTTATAGTTTGTAAAAAGTTTCTTATCAAACTTAAACGCGCTTTTATTTGCATTTATTCGTAAT
AATCTACTATAAAAAAGGTGTATTGTTCCTAAGAAGGTCTTCATTTCCAATAGCTCTTGGGCTCGAAGCCATTCGCTGCTTGCTCACCATGCCAACGACG
ACGCTGTTTGCGGACCTACCGCTGCATGGCGACGTGCAGCGCGCGATCGCGCGCATGCGTTTTCGCGTGCCGTCGCCCATCCAGTTGCACGCGCTGCCGC
TCGCGCTCTTCGGGAACGACGTGATCGGCCAGGCCAAGTCCGGCACGGGCAAGACCGCCGTGTTCGGCGTCGCGGCCGTCGAGCACGCGATCTCCAAGTG
CCAAAAGCAGCACCAAGAGTCGCACAGTGGCGTCTTTGGCGTCAATCCCATTGACCCGCTCGCGCTGATCCTTGCGCCGACGCGCGAGATCGCGTTGCAG
ATCGACGCCGTGGTGCGCGACATCGCGCGCTTCCGTCCAGCGTGCGTAATCCAGACTTTCATTGGTGGTCTGCCCATAGCGCAGGATCGGGTACGCTTGC
CAACAAGGATATGATTCTTTTCCATCTCATGGAATGCGCATTTTGGAAGTCGCCTGCAATACTCCATTTGCATATGCTGGATGTGATGCATTTTCGACAG
GAGAAGCTCAAACAGAACTGCCACATTGCGATTGGCACCCCGGGCCGCGTCAAGGCGCTCGTTGAGCAGCGCATCCTGCACTGCCACATGCTGCGGCTCC
TAGTGCTGGACGAAGTGGACAAGCTGATCCAAAGCGACTTTGAGAACGAGGTACGCTGCGACCATGGTGCAATGGGTATAACGACATTATCAGGGCTGAT
GAGGATTGAATGTGTAGATCCAATATATTGTGCGCGCATTGCCAGAGAGACGACAGGTTCGTGCCTCGCCATTTTTACTATTCGTCTATTATGTATTGTA
CCATTGCTGTATTGCAGATTTTGTGATTCTCTCTCACTTTCAATAGACGCTTGCATTCTCGGCCACGTTTACGACGGATCAGTTGGCCACCGTCGCGCAG
ATGATGCAAAGTCCTCAGGTACGTAATCACTTGCGCAGTGTCCGTTGATTAATCATTTCCCGTTTCTGGTGATTGACTGCTGTTACTGCGTTGTCTTTGG
CAAACAGATTGTTCGCGTTCGGGGCCCCGACGACGTGAGTGTGGAGCTCGTGTCATCGTCGCTCGAGGACCTCTCCGCGTGGAAGCAACGCGAGGAAGCG
AACGAGAACCCGGAGCTCTGGCTGCGTTACGTCCAGCAGTTCTACAGCATCGTCCCTAGTCAAAGCGACAGTAGCGACAATCCCGTTGGCCGAGAGGCTA
ATGATGCGCTGGGCATGAGGGCAAAGATCGTGAAGCTGACGGCACTGCTCTCTGAGGTCGTGTTCAACCAGTGCATCGTATTCTGCAACGATAAGTTCCG
CGCTGAAGCGCTCGCGACCGCATTAGAGTCACAAGGGTGGCCAGCAGCGTGCATTACAGGGTCGCAGAGCCAAGCAACCCGAAGCGATGTGATGCACCGC
TTCCGCTCCTTCCACACGCGTGTGCTCGTGTCCACAGACCTTACTGCCCGAGGCATCGATGTCGACAAGGTCAATTTTGTCGTGAACCTGGATTTGCCGC
GCGATCCAGCGACGTACCTGCATCGTGTTGGTCGAACAGGACGCTTTGGTGGACGAATATCCTTTTCTAGTTCTAACTCATGTTGCATGTTCGCATGCGA
ATACCCTGGTATGCGGTTTTGGTTCCCTTAACTCAGTTTCTGTTTGAACGTCTGTACGGCCTCGCAGTGACGCTTCTCCCCAAGGACGACGTGGTCGCGA
TCGAGATGCTGGCGCGTGTTTTCAAGATGCGTGTCGATGAGCTCCCAGAGCCTGTTCCGCGTGAGATTTACGAGTTTGTCAAGGACAAATCCGCGCATCG
AAGCGAAGACGTCGGTTCCGTGGTTACAGATCGATCCACCAACGTCACAGGCACGAGCTCGAATGGGAGCACCAACAGCGTCAAGATAGCATTGACATCA
CCGAGAATGCTTCAAATGGAGACACAAGTCGACGGTGAGAGAGAGCAAACCGCAACACCAGAGTCTCCATGTGTGCGAAGCGATGCAACTAGACACAAAG
CTGAAGCGAAGTACATTGGAAACCTCGAAGACCCCTTTGAGGCAGAAGTGAACGTGGCGAGTCCACAGAGAGCTTCATTAAAACTGCTATCGTCTACAAC
AACAACGAAACGGCGGGAAGATACAGGAGTAGGTCCCTCACATAGTGACGACAGCAGTACACGTGGGAATGCAAAGCGCACTTCGCCCCAGTACGAGCAG
GAGGAAGCATGCTACGCTAAATGGCTCACTTTTCTCTAATGCCGATTGCGAAGTATACAATCCTTACTCAAGTCCATCAATTAAAAAAACGCGAAGTTGC
GCTTTTAAGTTGGTGCGCAAGTGTGTTCTGGCAATTGGGTGAGTGCGATGCATCACGTGTAGCTGCATCTTGTGCTGGCGCGTATATCAGGTAAATGCAG
TATTTTTTATGGTCGTATGCTTCGGGTACTACCATCACTCAGGGTCACTGCGAACCTAACGTTGTCTTGCGATCTTGACGCGATACTCTACGCACCAACT
ATTACGACCGCATTTCCAGGAAAGATACGCCGAGCGAGGTCTCTCTCGAGTCTCAGTCCAGTCCTGAGGATTACTAGGAAACGCACGCATGCACCCCGCA
ACGTTAGTCTTATGGAGTTCATCCAGCTCCCTGGACACCAGATCACGTGTCTTTTTTACTCTCACTTCAGCATTCGCCTCCGAGCACGCAAGCGACTACA
GCTCGCTACCCTGCACCACCGTCGCATTCCCCATCAACACTCAACTCCCAACATGAAGATCGCCACCTCCATCACTGCCGCCACCATTGTCCTGGCGTTC
ACCGCAGTCGCCACGGCTGCCGACATCAACGTCATCGGCGCCAGAGATTCACCCACGATGATGCGCAAGGGTATGACCACGGACATGACTGCGCCAGCAG
CGGCCACTGCCGCGCGTGGCGTTGACGTCAAGATCGCCACCAAGGATGTGCTCAACCGACCCACGGCGCTCGTCAACAAGAACACGCTCGCCATGGACAA
CAACGTCTTCGTGTCGCGCAGCAACATCGTGTTCTCCCAGAGCGACCGACTCGCGCTGGCGCGCAAAGTGGAGGCGCTCGTCACGGAGGCCGACGCCAAC
AACATGGGCACGGCCGTGCTGTCGCGGAACGTGCTCAAGGCGGTGTCGGGACGCGATACCGACGCGGCCATGATGACCAAGGCGTCCGCCATCGTCACCG
CCAAGGACGATGCCGCGCTTCGCGGTCAGCGCATCTCGGACTCGTCGACGCGTCTCCGCGCCAAGACCACCGAAGCAGCGAAGCCGAGGCTGCTGATGGC
GACATCGAGGCTGGCAACCAAAGCCACGAGCAACAGGATGACGCGGAGCAGGACAGCCAGTCGCAGACCCCTCGAGGTGTCATTCTCGTCATCGGCGCCA
AGGACATCCTGCGCCAGCCAACCGCCGTCGTCAACAAGAACATGGCGCTCAGCGACAACCAGATCACGATCTCGCGGAGCCAACTGGCGCCCAGCCAGAA
CGACGCCGTCACACTGAGCGACCGCGCCAAGGTGGCGGATGTCATCGCGCCCGCGAGTGCCATCAGCACCACCATGAAGACCAAGGCCACCGGTGGTGAC
GACGACAAGGGACACCGCGTCGGTTTCTTGTACGTCAAGGATGCAGCCAAGCGGGACGCGATGACGACCACGGAGGGTAACGCGGAGTGGTGGGGATCTG
GCCTCGGTTTCGGCTGGCGCTACCCGTTGGGCTACTGGAACACCTTCGGCTATGGGCTCTACGGCGGCGGGTGCGGCTTGGGCATGCCATTCGGCGGCTT
CTACTACTGCTAGACGGCTGGGCTACTGCTGACACTAAAGGTGCCTGAGAAGGTGGTGTGTTTGTCATGTCGACCGATGCAAATTGAAGCTTCTTTGTTT
GCGTATGGAAAAAAGAATTTGATGTTTAATGAGTCTACAGCTCTGAGTAACTTGGTTCCAAGCTTTCTTTAATGGGCCAGTAGCTGTCGAAGGTTGAGAC
ACTTTACCATTAATGACAGACGTGAATTTCGTCTCGGTTGCTGGATCACTGCCCGTCATTTTGACCGGCAGCGTCTTAAAGAAGATACCTGTAGGATATA
TTTGTGTACTAGGATAAGACGGTAGCTGCTCGCTCTATATAAAGCCAATGCGCTTGGTAGCTCTGAGAGACTCTAGAGCCCTCATGTCATTTAGCTTTTT
CGTGAGAAACCTGAGGCATTTCTTTGCCGGTGGACATCGCCGCATCAATCCACGACTTTGGATCTACAACGGTCTTGACCATGGCGGATGGCAGCAACAA
TGGCGTCGTGAATGCATCGGCGGCCGTCAGCATCGGCAACTACAAGGGCGTCATGCTCTGCAACCGACCGTTTAATGGCGTGAGCAGCAGTAAGTGACGG
GCAACTTTCTTATTGCCCCGGGGCCGTTATCTTAACTTTGCTTTTGTCACGATTATAGCCTTGGCAAAAGAAAGTCGCGGCGCGAGCAACAACAATGACG
CCATCGGTAGCAGCAGCTTCAAGGCCGCGTTCCTCGCTGGTAACCCCAGCGAACCGATCGGGATGAACGTGCCGATTCTGAGTGAACCTGGGGTAAACTT
GGCAAAAGCAAGCAGCAAGTCAGTCTTTGCGATATTATTCAAACTGACTTTGTGAGAGTTTTGTTTCTCTGGGCCCTCTAGCACGCGATGAGGCGCGACA
AGAAGAACACGGCGCTCTCGAAACACAAGAAATGGCTCCACGACCTGCAAAAGGAGCGCGTGCGTTTGCAAGAAGCGCTCGTCGCAGATGACGCAGACAA
GCAAAAGCAGAAAGACAGGTCCGGTGGTCTCCCAAGCGCTCAGGCTTTACTATTGGCTGGACTTGGCAATTCACGGAATCATTACTCCATTCTCACAACG
CGTTTGCTGCTTTGCTCTACAGGTTTTCACAGCGCGAGGCCAAGTTTCGCGAAGCAGTGCGCAATAATAACAACAGCGACTCGGACGACAAGAAGAGCAG
CAAGATGAACAAACCCATGTGGGCGCTCACTAAGGAATCGGCGGACGAGAAGCTCGAGTGCATGGAAGACCAGGAGGCCGACAACCTCATTGACTTTGCC
AACAACCTCGATATCGACCAGTTCATGGACGACGTCGAGATCAAGGCGCGCATGGCGCAGGTCGAGCAGCAACTTGCTCAGATGCAGTCGATCGTCGAGT
ACGAAGAAGCCGAAGAAAAGCGCAGTGAGCGCGAGCAGCAGCGCCTCGACGACAAGGTCGTCGCGTTGAATGCAAGCGACTTGGCGCGCTTGGATCGCTC
TGGTTGTGGTCGCAATGATGATGACGACGACATGCAGAGTGTGGCGTCGAGTGTGCTCTCCGAGTGCAAATCCATTCGCTCAGTCCACTCGATGCGCTCC
ATGACGGCGCTCACCAAGCGTATGGAGTCCAAGCTGCTCGAGTCACAGCAGCAGAGTGATGCAGTCGTGAACCCGCGCGTCGTGACGATCGATGAGGAGC
AGGGCGCGCGCATGCAGATCAAGACGCTCGCGAGCAACTTGCCCTACATTCACCGCAACCCAGCTGTATGAGGGAGCAGGCAGATTATTAAGACCTTGGA
GCAGAGGAGACCTCTTTTATGAGTATGTTTAAGCAAAAAAGATGTCGCCGACGCTTCGTGCATTTGCTGTTGTTTCTTTCCATCGATCTCCTTGGGTCCG
TCGACCACTCCGTTCACTCTCTCGCTCGTGACATAGTTGCATACTATGGGGCGCGGTGTAGCTTCCAAGATCGAGGACGCAAAGAAGCACGGGCTGCTAC
ATCTGAGCCAATGCCACTTGCAGCTCTGTCCGAGCGCGCTGTTCGCGACTCCAGAGCTCTCGACTTCGCTTTTCCGATTGGACCTGAGCTTTAACTTGCT
CGAGAGCATCCCCGACGCGATCGGCAACCTCATCAAACTGCAAGTGCTCTGGTTGAGTCACAACCCACGGCTCGCGAGTCTCCCAGCGGCGCTGACCAAC
TGCTCAAATCTGCAGGTGCTCGACGTGAACTCAACGGCGATCCATGCGCTGCCGTACGAATACGGACGGCTGCAATACGTGAAAGTGCTCGACATTGGCA
GCACACCGCTCGAGAAGCGATGGATCAAGAAGAATCACCTCACTGCCACCTCCGGCAACGATGACGACGAGCCCAATGACTTGATTACAACAGCAACTCG
ATGCCAGGAACTCATGA