Description :
From Genome Similarity Track
Location :
contig_137:39523- 42422
Transcript NameFunction/comments
g11623.t1hypothetical protein PHYSODRAFT_503881
g11624.t1hypothetical protein

Sequence
2899 bases(100 bases per row)
TGTCCAGAGACAATGTCTTCGTCGTATGATAGGATGCAGCCACAGAATCGGAAGTCGGATGTGAATGCGTATGATTCTGTAGCGCAAGAAGAGCAACTGG
CAGTTAGCACGATACAACATCAACGTATAATGACCAATGCGTACCTCGTTTCTGATCACTATCTCGTATTCGTTGGTTTCCGTCTGCACGATAGTTGGCG
TCAATCGTGCCTTGCACCCGCAATACCGCGACTTTCGATTTCGATAGCCTTTTGATCGGGACCCTGTTTAACTCCGTGCGTGCAGCGAAATATTTCTGTA
GCTCCATTCATATCGAGAAGGCAGTTGATCTTCGTCATGCGTGCTGTGCATCCACAAAATAGCAAGTGTTAGTTCAAGCCCGCCAATTCACTCACATAAA
AATAAACTTACTGATTGTGCATCTGGGTTTTCATCGAGCTCCGGACGCGAAACTTGAGTTTATTCTTTCTTTGTACTCCTCGAACACATTGTCAAATTGC
TCCCACATGTTGATGACTACAGACGGGAATGGTGGTACCACATTTGCAATGTCGTCACGAGCTGCATCGAGCGCAGCGATTTCATCGTCGTGCTGACTTG
CACGCTTCCGAGGAGTGTATTCAGGGCGCAGCTGCTCCCCAACTTCGTCGCCACCCTGCAGTTGTTCGGATTTGTCGTCGCCGTCGCTTCCGTCAGCAGG
TTTGGGTTCAAAGCGTCGACCCTCCGCGGAATCCTTCATCACGTATGGCTCTCCGCCCTCATTAGCGTCAAAACAATCAACCGCTGATTTCGCCTGCTGC
TTCTTCGCCAGGGGAGAAGCGACGCTTCTTCGTTGGCATCCTGGATGCTGCTAATTATCAGCATGCAATGGGTTAGTTAGTAAATCAACCATACCTTAAA
GCAACCATGACCTTAAAGCAACCTTAATACCTGACATGGCTCCGCGACGGCTGCTGCCGACCTTCCGACCTTTAGATCTGCGAGCCTTCCCTGCTACATG
CACGCCACCAATAACGCGTCGTCATCAGCAACTGATAGCCATACAACCGGTCGATATCGCCCACATACCTGGTGTTCGTTCAGCGTCGCCCTCGTCAAAA
GAAAACAGCTCGTCCTCTTCTGACTCATCGTCTTCTTCCATTATGTAGTCGTCGTCGCTGCTGTCATCCTTCTCGATGCCAAGCGTGGCGTACATGTAGT
TCAGCGTCATCTTCTTAGGTTTCTTGCGCAGACGCTGCCCTTCAACAGACACAAACGTACACCCACAAAACATTCAGTGATATGCGTGCACCTCTACATG
CCAGCAGCGTTACCCTTACCGTGTGGGTCCTCCCCCTTTGCTGGCACCATGTGTCGTCTTGTGTAGCGCGGTATTTGCGCTTCGTCCGGTGCTCCGCGTT
CTGTACGTCTCGAGATCCTCACTGCCGCGCAAATTCTAGAATGGACGGCTCTGAGAGCTCCAATTTCGTACTTAGGGAATCGCACTTAATGCTTTATTTC
AGCAATTGAATTTTGGGATTATATATTACGGCAGAATTTTTGAAATTCGTCTAAAGCGACTTTACACTGCCAAAGCGACCCTACATGTCTCACCATTAAG
GTCGCGGTAACCACTCCGGAAATCCTGCGGGAATCGGCCCAATACCGGTACACGTAGCAGTAGATTCAAGGGTGATGGCTAATATGTAGGTAGTACTAAA
CCAAATTACTTTATTGAAATAGTAGTACAGATAGTATAATGTTATTACTACTGACAATGTGTCTTTCCAGCCGAATTAACCTACCAGCGCTGAAACGGTG
CCGTGGTAGAGGCACCACCAACGCAAGAGCGGCTCTTGATACCCGCTGTGTTGACACGATATATACGTCAGGAGCCCCAACCGGGGGGGGGGGGGGGGGC
AGTCTGTAATAGTCTGGATCAAGAAATGTCGCTCGCTTTTCTTGAGAACCGAAGTTGAAGTCTGCAATTATTCCCGTTGAAGCCGAAAGATGAATACATG
CATGCATCCTCTTCCTCCTCAGCGATTCCTCACACATTCGTGTGTGGGGTCGCACGGACCACCTGGCAAGTCCTTTGCATTCCCACCTCGTCATCAGCAG
GTGGCAGCTTTTTTTTCATCTTGCCACATCAGCTGCTCGACTATTAATACACGAATGCCTCCAGGACTGCCCTCTACTGTAGAGTCTACACCACCGGGTA
AGACAATAGCTTGAGTTCAAATCGCGAAGCGTCTCCCGTCCACAAACTCGCGCACGAGGTGATCCCTGGCACAATTGACGCAATGCGAGAACCTCATCAT
ACGTGTAAACTGTACAGATACATGTATTTACATGTACTGTAGCCCACTGCCTAAAAGCTTCTTTGTGTCGGTGCAATCGAACGAGCGTGAGCAAAATCGC
CATGCAAAGTCTGGCAGTTCGACGTAAATGAGCGACCACCTATGGCTCTCGGCAATCGGTTCGGCCAATTACATGTACGTGGCGCCTCTGCCGGCTGCCG
TCTTGTCGAAACCCGCCTTCCATGATATCCCACTCCCGCCATCACATATCCGACTCCCTCCACTATCCAATCACCTTCAGTTATCTATTTTCCACACAAC
CCGACTCATCCCTATAAAGAGGATCCACTATCACAGTTGGCATCCAAGCTGACTTGTTCTGACTCTTCTCTATTCCAACAGAAGCTGCACTTTCCGATCC
ATTCAGCCGAGCAGCTCCATTCCTCGGTACGCTACGCTTCACTTGCGCTCTGACCGCCTTAGGGACATGGCGCTCTCGGCGGTGGACGATGAGCAGCAGG
CTCGGCTCTGTGGGCGCGCGCGCCAAGGAGGTCTTCCAGCCCATGCGCTGGAAACGCATCGGGGCGTTGGCCGACGAGAACGCGAAACTCTACGAAAGC