Description :
From Genome Similarity Track
Location :
Scaffold_125:39523- 40943
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_14354putative DNA binding protein SART-1

Sequence
1420 bases(100 bases per row)
ATGGTCCTGGTCCAATATCGAGTGCTCTCTTTTATTTTTATTGCTTGAAAATACTTTTTATCCAAGGGAAGCGCACAGATTATCCGGACAGCCCACACAC
CAGAGCTGCGGAGAAGCAAGTATGGGACGTAGCCGCAGTCCAGCTCGCCACCGCAGTCGGAGCCGTAGCCGCAGCCGTGGTCGCAACAACCGCCACCGCG
ATGTACGCGACCGCTATCGCGACAATGAGAAGGATCGCACGCCAGAGCGCCGGCGCCGACGGAGCTCTGTCGAAGAGACCAAGGAGTCGCCAATGAAGGC
ACCAGAGGACTCGAAGCCCAAGGTCACAGAGAGCAACGGCGAAATCAGTATGAGTGTTGAAGAGACAAACAAGCTTCGTATCTCGATGGGGCTCAAGCCT
CTCCGCCTCACGAAGCCCGAGTCGAAGGAGGTCAACCTAGCCAAGTCGCGCGAGGACCTCGCAGCCGAGGCGCACCAAAAGCAGCTCAAGGAGACACTGG
AGAAGTCCAAGCGGAAGCGCGAGTATACCGCCAAGATGCAAGGCAAGTCCCTCGGTGAGACGCTCGCCGAAGATGCGACGTCAACCCTCGATTGGGTCCG
TCGCAGTCGGACAACGGCGCCTGCGCCTCTTCCAGGCACGAAAGCACCCGCGGCTGCCTCTTCTACCTACAGCGCGATGGACCTTGAAGGTCTTACGGTA
GCTCACGATGCGCAGTCGTTCGAAGAGGGCGAAGACGTCATCTTGACGCTGAAGGACAACCGTATCCTTACCGATGACATGGGCAACGTGAACGACGCTG
ACGACGAGCTCGAAAACGTGACGCTAACCGAGGCCGACAAGCGCAAGGAGCGCGAAGAGATGGCGAAGCGCGCGGCCGGACCCGTCTACTCGGGCTTTGA
CGATGAAGAGTTTTCGACCGTGCTCGGCGACCGACCCAAGAAGCGGCTGCTCACGCAATACGACGAAGAAGACGATATGAAGGAAGCACGGGCGCGCAAA
AAGTTTGCGCTCAGCGCCCTCGGTGGTCATGTCGTTGAGACGCCGTCCTTGCCGGCGTCGGCCGTGTCAGCGGGCACTGTCACCCTTGGCTCCATCAAGC
AATTCCAGGCCATGGACGACTACTACACGCCCGACGAGATGACAGTCTTCAACAAGAAGAAGACCAAGAAGCTTCGGAAAGAAGGGTGGCAAGTCGCGCC
GGCGCGAGAACGATGACGAAGACGAGGGTGAGAGTGCAACCAAGGACCTCGTCGAGCAGCTCGAAGCCGAGGCGAGAGCCTCTGCGGTCGACCACGGCAA
GCGCCGGGCGGATGCAGCAAGCGCAGTCGCGACCCTCGAGGCTCAGAACCGCGCGAAGTTTGAGAACGCCCGCCGGCGTGAGGCTGAGAAGGCCAAAGCT
GCCGCTGTCGAGGACATTGA