Description :
From Genome Similarity Track
Location :
Scaffold_1112:3952- 5366
Sequence
1414 bases(100 bases per row)
GAAAGGGTCGGAAGAAACAAGATTGAAGAGGATAGAACTGCCGAAGTTGCTGGTACGGGTGATCAGGATGCGAGTATTCAAAGAACGCTTGGAGACCCTC
CAACGTTGTACGCACGGTCACCTCACCAGCTGGTTCGGGAAGGGTTAAGCTCAAGAGTCGCTCGAAACACTTCTTGGCGCCTGCATCGGTAAACGCCATG
TCCACATACGGAAGAACCCACGGTGGCAGGGTGGACGAAGCCGGCACCGTAGGGCGAATACCAGATAACACTCGGTGAGGCAACGGCTCAACCGACGGTG
CACCACCACGACGCGGCACCGAAGTATAGGTTGCCGTAATCATGCGTCCAGGTCCAGCATCGAGAGTCCAAATAGACGGACGAGGAGACACTGGAACAGG
AAGAGAAAATGCTGGTGCCGGAGGACTTGCTGGTGGCGAAGGAGGCGGGCCGGCAACGATGATTGGAGAAGTCATCATCGGCGAAGGATTTGGCCGAGGT
GGAGTCGGAGGACGAGCTGGGCCAAGATTACTCCAGTTCCTGTTTGAATCTTCAACATCTTCGTCATCGAGTATGCTTGAATGATCGGTGGGGGGGGCGG
AACATCACCGCTACCACTGGGAGCATCAGGAGAGTCATCCACCGAAGGTTCATTGTCATCCACGTCATCTCCATGGTCGTCATCAGCATTCCCATCGTCA
TCAATCTCCATCGAAAGGCCAGGCGAAGACACGCTTGATACATCAGTCGTGGGAACAGTCGGAGCCGACTTCGAAGACGCGGAAGCTAGTGGATCAGCCT
CAACAGGGGCAGACCCTGCTGTAGAAACCACTCCCGAGACTTCAACTGCCTTGGATGTAGCGGCAGACGCCGAAGCAGACTTGCCTTGTGGGACAGTCTG
GTCTGACTCTTCACCTTCGTCACTCGAGCCAAACATGAGCCGCATTTTCTCGGCCTCGCGCAGAGCCTCTTCAGCAGCACGTATGTCGGCTGGAGAAGGT
GAAATCGTTGAAGCTGGTGACTTGGCCACATCGTGTGGACCCTGAGGCGGGGGCGAAGGCGCGTCAGGAGAGACAGGAACATCGTCGTGATCCTCAGGGT
TCACGTCCTTACCCGAAGGCTCTGTAGCAGTTTCTTGAACCGAAGGGACGCTGCCTGGATCAGCAGTCCCCATGTCCACGTCACTCTGGTCGCCGCTGAG
GTCGATCACTGCGGGAGTCGAGGAAGACGCTGGTGTAGGAGGTGGCGACCATGAACTTGGAGAAGACGGTACAGACTTGGACCGAGTCTTCATATGACGT
CGTGGCGACTTAGCAGGAGAATGTGGGCGGGGTTTCTTGCGCTTCTTCTGGTCCGCCTTCTTCCACGCCTTCGGACCGAACAGCGATCTACGAGCCGACT
TGGGAGTTGAAGTA