Description :
From Genome Similarity Track
Location :
contig_7:39512- 40598
Transcript NameFunction/comments
g1990.t1hypothetical protein

Sequence
1086 bases(100 bases per row)
GGTCGGCGGTGACGGCGGCGGCGGACTCCGAGACGGTGAAAAGTGCGACGGCGGAAGCGACTACGAACCTCATGGACGCTCGCATTTTACTGTCCGTGCT
CAAAGTTACAGTACCGCTAGTCAGTCGACCGCCTGGAAGGTATTTAGCCATTTGAACTTGGAGACGTGAAGCCACGTTTCCAGTCCCTTTGCCGGAGCGC
ATCAGGGTTCCCCGAACCCAGGCAGATTGGCAGAGCGATTTGCCGCATTATTGCTGACTGGATTGGGCATTTCCCCGCATTCCCTGCGAAGTGCCCTGCA
TAGACCGGGGCTGCACAGCACGAATTGGATCTCAGAGGCAGCATATGCCGCCATCAACATGTGCCGCATCAACATGTGCCTCACGACGTGGCTCACGACG
TGGCTCACGTGAGAGAGAGTCGCTACAAGGACTCGGACGCATTCAGTGGTGAAGCGAAGGCGAGCGCGAAGTTCGCGACGGAGACTGACTCATGCAGTCT
TTTGGTGAAGTGACAACCGTGGGGTCACTGGCGAACGCATTTTGTCGTTGGCCGACACTGCAAAAGTCAACATTCGGGTTACACTGTACTGTAGTACCGG
AACTGTATTTTCAAGACAGAGCGAGTCAGATTCCGACCAGATTGCCTACCGTTTTGCTCTTAGCTTTCGTGCTCAGAACTGTCAAAATCTAAGAGGTAAT
CAGATACACACAGGTTCTATTCAGAGGTAGACACGTTGCAAAATTACCCCAGGTTTATACTTACTACTAGAGGTAAATGTCTTTCAGCGCAACAAATCTT
GGTTCATGTGCTCACATGGTAAGGAACTCCAACTTGTATACGCCGAGCAGTGACAGCATCGCTGATGCATGTGCACACAATCTAAAACTGCTGGCGGATG
TACGGCCTTCCTTCGACTGCGATACGGGTCTATCAAGTCCAGAAGCGTTAGCGACATTGATAACTCTTGGCATTGTTGGTTTATCCAGCTAAGCGACAAG
GCTCCCATTCCAACAATGGTCGCCTCAATGAGAGTCCTACTCGCAGCTTCCGTCGCTTTCCTCGCCTCCACGACTGCCGTAGATGC