Description :
From Genome Similarity Track
Location :
Scaffold_3:39511- 40795
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_3-snap-gene-0.49Gene of unknown function
Pytve_DAOMBR484maker-pve_contig_3-fgenesh-gene-0.29Microtubule-associated protein EB1

Sequence
1284 bases(100 bases per row)
TGCAGTCCGTGTTCCGAGGATTCTTCGTGAGGCGAAAATTTGCCGCCGCGCTCGAACTGGCTGGCACAGTTGGCTGTGACGAGGACGGCGATTTCGACGA
AGTGAACATCGACGATCTGATCCAGCTACCCCCAGAACTGGAGGATGGCTGGGAGAATCCCGTGCTCCCATCAGTCACACGGGAAGCTCAGCGCTCTGTT
CCTACTTTCTCATCGTTGCGATCGCAACAAAACGGTTTGGACGGAAACGTTGGAACAATGGTCAACGCTTTCGATGATACCAGCAACGACGACGATGTCG
ACGATCGAGAGGAAGATGACCCCACCACTTGCGACTACAACTCAGTAGCTGCTATCATGCGAACTAGAGGACCGCCTGTGACCAACAGCAGCAACAACAG
CAACTATAGAGAAGCTGCGTCGCCGCCGAAAGAAACAAATTTGGCAGCATCGCTGTGGAACAAGATGCGGCGCAACAAGCAAAAGCAGAAGCGCGTCGCG
GAGGAGCGTTCTCGACAGCAGGACCCCGTCTACCGCGTGCAGAAGCTGCTCCAGCCCAAGAAGAAGTCGTCGCCTGCTCCTTCTCACCAGCATGGCGCAC
CACCACCTAACACACAGACGACGTCGGTGGCGTGGACGTCGTCGAACAATGCTCCAAAGCCAAAAGTTAAGCTGCCGTCGCTTGTCGAGCGCCTGCGCAA
GAAGACGGAGGCGGAGCGAGCGAATGGATGAACAAGCGGCGCTGACAACTCCAAGTGTCATTTAGTCTTAGCGCTTGGCGAGCAGCATCGACTCCTTGGT
CTGGCGCATCATCATGACGAACACGTCAAAGTCAGCTGTGGCCACCAAGATCTCGGAACACAGCACGAGACTCGACTCGCGGTCGGCCTCGTACGCGTCG
CGCACGAGCTGGTAGAACTCCTTGACGGTCGAGCCCTGCGCGACAATATAGTCTTCGAGCCACCGCGTCACTACGAGTAGCTCCTGGTATGCAGCAGCAT
TTTCGAAATGTGCACCAACCTTCGAGCTTCTCTTCGAACAGTGCGGTGAAGCGGTTGTAGACCTCGGTGTACCTGTGCAAAGGCCGCCATCAGCTCTCAG
AGAGTAACATGAACAAACCATACGTTGAACCGCACTCGAGCTTCATCTCTTCATCGTGGAGATCAAACACGTCACAGTTCTCCTCGGCGAACTTCTCGAA
TGTGCGAGCGAACTCGTCGTCGTCGAAGAAGAAGGAGATCACGCGCTTCACCAGTCCGTCGCTGTCGTCGTCGCCATCTTTTGC