Description :
From Genome Similarity Track
Location :
Scaffold_170:39511- 40749
Transcript NameFunction/comments
Phymu_g5987hypothetical protein PHYSODRAFT_486841

Sequence
1238 bases(100 bases per row)
GATCAACGACTCCACTACTACCACATCTGCTACGGGGGATGTTTCCCCGGTCCTCATCAAGAACGCACTCAACCTCGAGGTCGAACACGCCCCACTCACC
CACCCCGAACTGCGGGGCGAGTTCCCCACCAAAACATACGACCCGATCCCAGTGCTGCCGTACGAGGATCGCGCGCTCAAGGCCGACCCGACGTTTAAGA
ACCTGCTGGCCGACGCGACGGTGACGCACCTGGAGCCGAAGATCGGCACGGAGATCTCGggtctccagctgcacgagctgtcgGACGCTCAAAAGGACGA
GTTGGCGTTGCTTATCGCTCATCGTGGCGTGGTGTTCTTCCGTGACCAGAAGCTCTCGATTGAGGAGCAGTTGGATCTGGGTCGCTACTACGGCCCGCTG
CACGTGCATCAGACGGTCGCTCACGCGAAGGGTATTCCCCAGGTTCACGTGGTGGAAAATACTGTGGAGGGAAGCCAAAAGCGCATCAAGTCTCAGCTTT
ATGAGCATGTGAACGTTTGGCACAGTGATGTTTCCTACGAGCGTCAGGTGAGAAATAGTGTCTGTGGCTTGCAGTTTTGATGTCAAACTAACTTTCTCTT
TCTGTCCGTAGCCTCCATCGTACACGAGTTTCAAGGTATTAACTACTCCGCCTACTGGTGGCGACACTCTGTGGGCTTCCGCATACGAGGCGTACGATCG
TCTGACGCCTCAATTCCAAAAGTTTGTTGAGGGTCTGACTGCtatccacagcagcaaggtACGAGTGGAAACTTTGAAACTTGGCGTGTATTTCTCCTAA
TAAGCACTCGATACTCTTTTAACTGATCTAGCACCAAGCTGAGAGCGCGATCGCGAACGGCCAGACCCTTCGCCGCCCCATTGTGGAGTTCGAACATCCT
GTTGTTCGTACTCACCCGGTGACTGGCCGCAAGGCGCTTTACGTGAACGCCCAATTCACTACACGGATCAACAATTTGTCGGTCCCTGAATCCGGTACGT
TATGTTAGATGTACCTAAACTTGCACACCGCTAACGCTGGCGCTTCAGATGCcatcttgcgcttcttgctaCAGCATATCGCCCAGGGACAAGAGTTCCA
GTTGCGCTACCACTGGACGAAGGATGCCGTGGCGATTTGGGACAACCGTGCTACAGTCCACTACGCCACGTACGATTACCTGCCAGGCAACCGCCACGCT
GTTCGTGTGACGCCGCATGGCGAGATCCCGTACTTCGA