Description :
From Genome Similarity Track
Location :
contig_25:39505- 41272
Transcript NameFunction/comments
g4887.t1hypothetical protein

Sequence
1767 bases(100 bases per row)
CTGGCCTGGGCTACGCAAGACGACCCGATTCCCCAACATAGCTGAAATGCTTTCGCCTGCGTCGAAGTCGTCGTGCCAGATTTCGAAACAGGTCTTGTTC
ACGCCCTTGAAACTCCGCCGAGTTTTATTGCAGAGCCACAGCTTGGCGGTGTTCACCGAGCACCGCTCGCAAAAGAAGGTGGTGTTGTACGACTTTTTGG
CGTCCGCACGCAGCAGCGCATAGACCTTGCATGAGTGCTGCCGGCGCTTTTGGATGTCGCTAACTGTCAACCAACCCTCACTCTACTCGAGCAGGTGGGT
GATCCGGACCGGTGCACGCTTGCGCTGCCGGAAGCATGGCTGTGTGGCAACAACACCAGCGAAGACCTCGGCCTTCAGCTGCAGGAGATGATTCTGGAGT
ATTGCGTACCACTCCCCGCGGTTCATGACTGGTTTGCCAGCCATCACGGCTGCCTCGTGGTGGGGATGAACGCGTTGACTACTGCTAGGTCGGTGAAGCC
AAGTAGCAAACTCTTATAGTACTTGGTGACCTTTGTCGACGTCTGCAAGGAGTATCGCTGGAGGCGGAGTTGGTCATGCACATCAATTCCCCTATCCAGG
TTTGGTAGATGGTCGCCGGTTTTGGACACGGTACCGTGATGGCGCTTGATTTTTCGCCCGATCGATGACTCGGACATGACCGCACCCGTGCACGGGTAGT
GCATTGGCTTGCGATCCCACCAGTGGAAGGCAAACCTGTTTGGAACGGCAAGCGAGCGTGAGAACGTGAATGTGCCACGGGGGATGTTTGCCGTACGGGT
CTTGCGCTTTTCGTTCACATTATTATCGTACCCCAATCGTTTGGTTATGATGGCGCCGATGACGTACACCCCCATGCCGAGAAAACTTAATGGAAGCAGG
ACGGACGTGTAAAAGCGGTCGACGACGACGGCATGCCACTGATGGCGCGCGCTTGATCCGAGGACGATCTTCAGGTTGCGGACGACTGCTGCAGCACCTG
TCTTGTGATCAAATGAGGCATCTCCACCATCACCTGCTTTTCGCTTTCCAGCATAGAGCTCGAATCTAGTCGGATACGACATAGAGAGTTGACTTTGGAC
CCGTAAGTCGCAAGACACGACATCCGATTTCGTCCAAAAAGACTTACCTATGAAAGTACGCCGTCCTTGAGTCGCACGCCATAAATATTTTCATCCCCTA
GTGGTGAGGCTTGTACTTAAACATCCGCGTCGTGTTCCGAAGGGACGTCGACAGCAGCACACTTCCATCGAAGGAGAAGACTGCCGGGAGCGACCAGCCC
GCCAGGAACTGCTGCTGTAGCTTTGTCGCGACTGGTCGCAACTTCCAGAGCTTATCGCGCGAGCTAGGAGCCTCGTTGTCCACCACGTGAAAGTCCCGGA
GGATGTCCTGGCAACGGTTCCTCGACATGAATCGCCCGAAGTTTCCGGCTGGAAGCACTCCATCCTCGGCCATCGACCAGTGTGCAGAAAATCGCCGCTT
CTGTGAGCACAACATTTGCGCCACGAGTAGCCCGATTACATGCAAGATCCCGTGGGTCTGGTACCTTGGCTTCGCCTTTAGCCGGCGGTGGGTTTGGACC
AGCGTCTCGCGCCGCGATGCGGTCTGCTTCGCCTGCATTGCCATGGCGCGGCGTTCAACTTGCTCGAGACTGTAACGGTTGGTCTCGACGTCGATGAGCA
CCCACAGCGGCTTGAGCATAAAGAAGAAGAATGACTCTAGTGGTGAGTCTTAGAGCGCGCGCAGCTC