Description :
From Genome Similarity Track
Location :
Scaffold_18:395009- 407158
Transcript NameFunction/comments
Phyca_LT1534110544Hypothetical protein
Phyca_LT1534545526Hypothetical protein
Phyca_LT1534110472ATP-dependent protease hslV
Phyca_LT1534545532cAMP-dependent protein kinase regulatory subunit

Sequence
12149 bases(100 bases per row)
aatatgcgagcttctttttctccctctcgcgaaaaaattgtcatagcagactgtgcctcgaagtattgacacgttatcgctggacgccgaagctagtcgt
acaattaaacgcgagcaccaaagcgaaagcgttaacgatcggctgacgtagaatgggattaatcgaatccccacgtgttgattccagacagtccactcga
gaatgaccgtgtcacgaagtccggtatcatccacgagaaaaatccgatacattattcgaagatggtcgattagcagaaggcataacacaggagcagcata
tcgaacacgaaatttcaacatccttcgtgccgttggagtcaatgcatcgagcgtaaaaacccactgagcccatagccaccacgataaaaatgtaagacag
cgcgagatgttccaattgtacaggatacaaacgccgatatctgcacatgtgatttgaaacgagtagaaggcgaagtcgaaggacgtgaacaggagcttga
gtagttgacgttgatacagagctgtaaagagacctatgaacgcagcggtacacagtaacccagtgacacatactgggcacatgagttcttcctgaccttc
caattcgtgaaaaagagagagatgcgaaaggattaaccctcccaagccaaccgaatagacgatcgaaagaaaccaagtcggaaaacacgtctcctttaca
atgttgcatggcaggagtgtattggtagcgtcaaaagtctgcgagaacttgacaaacatcaagtgctgaatcacgtctgcacctcgcagtgaattttctt
tcgaatgacatcttgaatcctcacttgccaacgcgagcgaaagtgacggcccagctaccgactccagtttcagccgacatcgataaatgacacactgaac
gatcgctgatggtttattcctcactcgaagatctttccgtcgtcggaaaacaaccttggcgactaggaagctcagtgacaccattccgtttccaatgacg
tcgataccggagagcttgtaacttctgtccatattctcgtacgtcacaatagtaaatgtcgacccaccgtcaacttgacgtaacaagatccacgtgagca
ctacagaagcagagagtatcgttacaaccaggaaatacgttaaacttcggagtcctaaaacatgcgcatcaaccaaaacgacgtggtgatatccaatcca
atcgatgagcattcgaaccgaccgtaaatcgccaaagtacattgacatcgtgacagtgatagttgtcgtaatagcagagaagaaccaaaagtcgaaagtt
cggaaaaccagacgcgcgatatcgtatctcagtgtggtaatactgcccaacccgattgggatccataagagagcggctaatgtcgcaattattcgaccaa
gtcgtacgtctaccagtggaacgaagacatttaaacaatacgagatcacagcacaaatcagaacttctcggtaatacttgtagtatttgcgacggataaa
cgtgtggactctcccaggtagaagccgatctcgaaaagatttggacagatccactacaggaagaggttgagcaggtaccagtgcgtagactagacggcta
ggttgggagttctccttccttccgatcgacatgaagaccctgttagtatttatttatgtgtctaacaggtgtcgataacgccaaaacaaaaacagaaatt
gtattttattagttcatctatttggttgttaatgggataacctgaatctgggaatttctccgtctcctcctgacaaaacagttttcgaagcaaacaattc
cgcggagaatgatgacgtcactgtcggaagctgttccaaaccggataagcaatcgagagcaccagagtaataacgtcaatgaacggcctgcatagaaggg
aataacgcggatactgacgtgttgactccagactcgtccgtcaaaaatgacggattcttgcaacttggtatcagtaacaaagaatacttggtaaattaaa
gcgacgtgatcaatcagcaggatccctaaaatgaaccctgcaaaacgaagacggagttgtaacttgtttctcatcatcggaggtaatgcatccaatgtaa
acagccaatgtgcccaaagccaccaggatagcaccattaaacattgcggaaggtcccaaccatacaaactgcagacgcataaacctgctgctgtgaattg
aatcgagtaaaacataaagtcgaaagaaaaaagcaacaatttcagcaattggcgttggtagaaaacagcgatcgaggccgtaaatgtcagtgtacacact
agagcaatcagcgatccctgtagctccagctgctcgataaactcagtttccactccctcgatcaactcgtgaaagagaaggatatgtgagagaagaagac
ctatcacaccgacagtgtataacatgacgagtgaccaggttgggaatgatacttgggccattccccaagaaaataaagtgcgagaagagtcaaatgaatg
cggaaacttgacaaacagcaagttctgtactgttgcggcccgattttgttttgacagatcgctcgaaacccacgccgtgatgattttcggcttgtgttcg
ggctccagtttcagtttgcaccgataaatgacgcactcaactaatgctgtagattgcctgcgtcgtggtcgaagttttctgaaaattattcttccgagga
gaaaagttaatgacaccaacccatttccaattacatcgagacttgagaggttgaagctcccgtgcatattctggtattttacgatggtaaaagtcgaccc
tccgtctacatttccaaacatgatccaggagaaaacgaataaagtagagacaattgaagcgatcaggagatacgtcacgtttttaatacccaacacgtgt
gcgtcgacacataggacgtgatggtaaccaacccagtcaatcaccagtcgcacggagcgaatatctccgaaatatttccacaacatgacggtaaccacag
tggtaatgattgaaaagaaccaaaagtcaaacgttctgattgcaagacgaacaatatcataacgcaacgtggtcacactgccaaatcccaacgggatcca
tagaactacggccaaaatcgcaagaacttgccccgtagatgctgtgaccatcggtagaatagcattgaggcagtacgagacagctgcgcacagtaggatt
tctcggtaatatttgcagtacttctggcggattgaagtgtgaactctcgctggaagaagacgaccgcggaaagacttcgatatgtcgactaccggaagag
gatgagctggcaccagtgaataaataacgctgcaactcgtgttgttgatcccgtttgtcaacatcactgcaaaaccagcgcgatgaaaacgcagataaag
ttttttgttgtaaacctctgctattttaattctgcctcaccacaagcataaggtctttgaagatgctcatgaagaaacagaaatacttcgacgtagatca
tttttaaattctggtactcgtaagaattcttggacggaattatgcgcataaccctggttaaagactgcaaatgaatcggctccagctgaccattttcttt
tgtctcccgtcgtatgtgaagggtcttaagttttccgaagatgtttttccaactcattaccaatcacatctacctgaaacatccgtattcattctcgtat
tttaagacagtaaatgtcgatccaccatcagctaatgatagcgtttactccaagtccgtgcaacgtcctcactccactgtacacgcttctatcgataatt
tcattgacggatcgattaccccacgagaatgccgtatgaacctcgccgtccgtctaaaaaggccatagtgatgaaccacagagcgaggtcagcatcatcc
gatccgcgatcagcttcagaacggcaaggaccacgaattcccccatttcccactcgttttggtttgttctggagacaaaaaccaacggtgacacctgcag
ccttgcaatcccttgtagtggcagagcagcacgcgagtggaaattcgcttcaacacgacccgaatgacagcatcgtgttccttaatactccaattgagtt
cgacttgcgctcgtattttttcaggaagcagaagtcgttcaaaacaacagaaggcctcgagcggtcagcgatcagccacagatccgctagtagccgtcgc
agtcaaacaaaccctttgacatccatggatacgtcgtacacaggggatcagccgtttcaaccagtagccatgaaccccagctattcccccgcacagcaaa
caaaaaaaccacgacgaaggctgcgtgcaagcgaagagctctgcatcgtgctacctcgatcgacaagtcgaggacgaacacgatcacagaaatcttggtt
cttagggccaggatttattggacgagatcctgcagacggaacgtttgccgctacaaaggacaaatccatggacactgtgcacgccgagatctccatatcc
ggcgataattatttcatacgtgacgcccaaagcacaaccggtaccttcctttgcttaagtacacgataccggcattattcgcagcgagatgggtttcgac
tgcgcagtggggatgtctttcgcatcggaccagctacttccattcgcgttgaggagctgcaaacgtccatgaatcatattcccctccgtcgtaagtctcg
ctctagttcaagttcgaatcttgaacaacttggtgtaaaacctgaaggcaatcacactcataaactcgaacgaacacccagcaccagcagtgcgacgtca
acaccagtgttgaggccgatgtcaaccgtcgagaaacttcgtctcctcactacagatacggaggatgaactcgtacatagtcggcggccctcaatcccgc
gaagaacaagtctcgaacgaaagccacaacacaaagtccagttctccgatacacctccaatcatgtccgatggttctgttttccttggtagtcgctatct
ccgaccagaagtgaaagaattgcattaccatgagccttctcaagtagaagatgccgacgacgacatgatccagaagctcgttggatgtgaccatgaccca
tcaccgactgaacactcgagttcagcaaaactcgtaaacctgtatcacttcgcctcgttatttttcaacacaatcccgccaaagccagcacggagcctct
tcaaactcaagatgctcgcgaagtttttctaccagggcaacaatcgtacctgataggatcttcagcagcctgtgacgtgcgcattttcccctccgaaggc
attgaaatccatgctgtgcatgcccgaatcgtcttcgacggcgtatccttcatactgcaggatgtatcctttgaacgtgatccacgtcgacaaacacgcg
ttctgttggctcaaagacccgtgaaaatcactcgtggagattggctgctactcggtaaatgcgcactgtacgtcacgacggcagcaagagcttttggctc
ggagcgacgaccggatatgaaagaggcagctatgcgcttggacgttttacggttatccaagcggaaaccacgcacaaaaggcctgtttgtccctgtaggc
tttcgactgcagtgtgcctcgggttctggggcatccagtggaagcagtggatggggtggtagcagtggtggacctgtcacattcggcaaaggccgagact
gtgacgctcaagtcttcacagcgtctttatccaccgaacaattcagtgtccagctcgagcggggaacttgtctgctcactcctagacccacaggcctcaa
tgccggcacgtatttcctgatcggtcgcgacgaagttactccatctcttgaagttggcgtcttagacgatactgaagaaccgggtggagtcgaaattgtc
aagcacacaagtaagccgttgctgctctctgaagggtgcgtcttccggtgcggtggcagcgagatagaggtcatctgcgtgaaaaacaccaacggcagga
gctccttggaacaagaagagcacatccggtttctaagcgccatgtcgtggttgacaccaatcgcgactgacttgaaaatgatcgcagttgtcgcacgctg
cggccagagacttcagctcaatgctggggacttagtctacgagaaaggggacgccgcaaattttgtcttcatcgtaatacacggtgacgtggagcttttg
gaaaacgaactgcctgtagagagccatgaaatcgagcaagtatctccaggggggttctttggagaagagagcttgcttgatcctctggaacagaactctt
tgacaccacacaccgacgaactggaatacacaaacactgcgaaagcagctaactcttgtgaactgctagctctggccagagaagatatgtgcggatatct
cgaattgtacttggacattatccgcgctcagttgaaacatgatcggtgtcgagacagggtcatccgttcagcatgcggctgtatcccttggttacgggac
atatctatccaagaaatgcgcttgctttcagctcatgcagaagtcactgtgtatccccctggatcgactttgtttgaggacgggaagctgtgtgttcctg
ctgcttttgccggtggcaatacgttccaacttcgagacgggctccttgtgctccaccgtggggatgcacgggttgtgagaagcaagcacgaacgacagca
cttacgaaacatgaagatatatcatgccaacttcgaagaggagcatcgagaccttgaaagtgtcgatgatgaaccggacgaacgctggagtcccatggag
ccagtgattgccatgagctcacggctctctgagtcggtgctgaccttcagcaatttgtcattccgtgttgaagcatgctccacagtcgagtgcttcttca
tagccgcagttcatcttgaacacttgacagcgtccaaagaagtacaaactgctagttttgggcatgaaccagcaactgtcgcccagattccatcttctat
aaaacgaggcaattcgcatgtgggaagacggctgcatcattcagaggtagtcaccagctcactccacaatgacgccaatgcctgcgaagacgaagaccaa
atggaagggtcggatggggacggagattctacaggagcacgtcgctggagacgtaagaagcgcaacaaacatctactggaggaaaccgttctagagacac
aaaatgacgcgcaaatacccaatgcgttagtcttgtacgtactggcgggggcacaacggggtgacatccacgttgtccgtaatgtggcatccattggtgg
gcttcttagcggggctgacatcgaactcaatgaccggtatgtctcccatacgcatgctgtcattgagtaccacgacagcaagtactggctatacgataat
ggcagcaaatggggtacattcgtgcgcctggaggaagacaacgctgtcgatatcaatccaggagatgttttcctggccggtgagatcgaattcacttgcc
ttgctgcataccccgaacgcaataaaccgagcatgtgctgtttaatgtaactaaaccgcaggaaaactgtgaaaatagacgtgattagcaataaaacgta
ggtcaaagcatctcgagcattcagcatttcacctagtcaacagtcttatggggggacgcaggtgatccaactagtacatgcgccagcacatcagcctgtg
cgaattcctgccccgatcggatgtcaacgcatactgggcctcccaacgcctggagtccgcccacaatgggcagaaactccatccacacggtcttcatagt
cttcgcttccattacgtccaggttctggcaatgtaaaaattgtgaattagcgcaacagtctttaaaatactgtgaaggacaagtaaagcgtacctggtga
gatgctgatgaacacacaataccgtgcataagttcctttcggaattgaagttgcagtgccatagtccgagtggaattattcgtcacagatacagctgcca
agaagggctgcccaacaaccacttccttcggcaattcgtccacagatatcatgacttcactgtgctgtcctgcagggccagccccaggaatcttcctcat
caccggttgactttgcacagatccagcttcacccattgatgtcttccaccccacatgaagtcgaccaagattttgtgatccctgcaaaacacaaaggtca
gtacgaaacaggaaataccatcaggggatgctctgtacctgtgttgatagcaacgacggatctgatgccgggtcgtacgccactttaaagacacgctgaa
gttcttcctgagggtacataagcgtctgtggcccgttgttcatcgacagcaattcttcaatcgaagtttgttctccttgtttcttggccacattttgttt
atgcatctcttccgatgtaaatggaggtagcggcaaaaacttgatactatccacaaaaagcggcattttggacacatttcgaacctgagcttccacaata
gcctctccctgatgctgccgtgacgctaacgagtgctgcttgaacgtaatcaccagtggattctgcactgcgaaccgataaaatttacgtagcgacttgt
tctcacctgtcactggatccacataggccactcccacacgcagcacgtgatttccgacttggttcagagggtaatccactaccatatccagactggagcc
agcagttagcactgcaacaggattgggcggaggaagtttccctgttcgagcatagcggttgtcatgtagctcaacgcggtcattggcgcattgaatattg
gccgagagcccgacgtctcgtagttcacacgtgtacgggttaatgacgctgatgtagctgctgaatgtgttgcctagaaagatctctctaatatggaata
atgttaaaacatactccaattattacagcacattatggacgtacccaaagctgtccggtagaatgagcatactagagagtgcaaattcatgctgtgtagc
agtatcttcggccatcgacgtgggcagcatcgagcccccgctggctccttgcacgtagagcttgggcttgtacaaccgcatcactttgagataatatttc
atgacaaataagaggctattacaaacgagagagacaggaatgcaacaccgcacctttgagtgtcggctgcacagtcggaggaggcggagatggcgccggt
ggagcgcccccgcccgaagaaggcggcccgctagtcgcgtacgcggagctcatgatctcagactgcggaatgttgcagcaggggctaaaagcttaagttg
ctcgtctgcgcttgttcagatagtcacaatgtcgcgagaaggttgcttgtacagggcagagcttgtggtcaagctcatttagaagctgaggaagatgctg
gctcgctcgctgttccgcgctgcctcgagcgcgcgcacgtcgccatcactggccgccgccactgcgaactttggtgcttcgcaggtcgctcacttttcgg
aggcccccaaggtacaaaccgcactctttttacgtaaaacctgtgttttaacttgtcttctttggtgctaaatggcggtagatgcgcggaacgacgattc
tttgcgtccgtaagaacggcaaagtggtgcgtacaaagctgtgacttacctgtattattattgtcgagaggggtgttcatgtgtacttttattattgacg
tagtgcctaatcggagacggtcaagtgtcgctgggcaacactgtggtcaagcccaacgccaagaaggtgcgtcgcatcggggagcacatcgtggcgggct
ttgccggttctacggcggacgccttcacgctaatggagcgtctggaggccaagctggacgagtaccttggtcagcttacccgctcgtgcgtggaactggc
caaggcctggcgaacggacaagtacctgcgtcatctggaagctctcctgattgtctcagactccaagcagtcgtacacgcttacgggtaacggagatgtc
ctggagccccacgacggtattatcggcatcggctcgggaggctcttacgccctgggtacgtttttagggataaatgcaggctagctgagtgactgactca
ctgccccattgtcacgtgtgatatagctgctgctcgcgctcttattgaccaggatctggacgctgaaacgatcgcacgcaaggccatgaaggttgccgcc
gatatttgcatctacacgaacgagaactttgtggtggaaatgctcgaggagggaaaggatgaccttatcgaagaaaagaaagagtaaacgtcgaagcttt
ttgcatcaagcttttcaggaaggtgacgtagaaatatcgcacttctgcagtaaaatgctggaaagtaaatcaacgtgcagactgtttgatctcgtcgtca
agaagtgtagataaaggatattgtatgatagtcatagtcagacagaggaagataaaggaacgctgcacataggtaactgcatcgacgctaccccgcccga
taggcgaggcgcgagtgcatcgatatgcagtctgtgctacttgatccttttgcctcttgcttctcgaaaatcgtggtggttggaaggcgtgtataaatgt
attggtgcgcttgtgtgatcctgtagctgcttaaatgttgttggcaatgaccgagttgtacttgtcgatgttgcgcttcaggatatcttctagcggaccc
attacccgcttgaatgttttacggtccaacgtgaggcacttgaccttgcccttcgctgtcactgttgcctggcgtggtcgtgttgtaagtagagcaattt
caccgaagtatgcacctgaagtgaggtcgcccatttccactggtggctcagccggcgagagctgcttcgtacacactgccgtgccttcttcaatgatgta
aaacaagttgccatcgtcaccctgggtgatgatgacttcgccatcgctaaacgtctccgtcttgagagcatccgccactgtgaggcgctcgtactcgctt
agcgactcaagcagtggtacacgttcgatgaagcccttgtgcgcctcgcgtttcttcaaagtcgtctccatgataatgaacttaaatgtctgtcgatcca
atgcccaagccttcgagtgttgtactgctttcacagttgcagcacgcggagcgttgtacataagcgccaactctccaaatgacattgcctctgtgcacta
tattggaaaattcgtcagaatgaaaataaccaacaaaaacagccacgaccagttttcatcatgtaacgcaccgtttgaacgagttcgccgtccttgtaaa
cctcacagactccactctcaaggatgtagaagttatctccatcgtctccctgcttgatgataatgtcaccaggctcgaactccttaggaaacatggcgtc
gagcacaatgtcgtgttgtttctcatccaatgacttgaacaaaatattctcgacaaccatgcggctaatgcattccctctcctctgcagacttgggatgc
accacacgctcaaattgccgtgcactgccacgtcacatgcaaaagaagaacatggtcaagttagcagacaggacgcatgtggcatcaattggcattcacg
aacctcagggggtcgatagtttcagcggacaccgaagtgcgtcgccccttggccatgatcttgggtggtggtgcgctggcagcgatctctccgacggcgt
cacctccttcgtcctcgtcctcactctcactctcgtccgagtgatctagcagcagcaaaacgagaaatgttttatcgttagatctctcctctctctccca
aatgcaaagccaaagagtcgcgtacattgcgcatgaggtgacgcggcggggttgtcatctttagcaccaggtttgaggcgcggtgtggcttcctccgggt
agtttgtctgcaggtactggatgatatgcaggatgggattctctggcttggccagtagcagcgactcgacgaggttgatgaacagcgtgttgatgccctt
cttgtgcaggtagtcctgtagttcctgttgcacgccctctgcgtccgtcatggttgctggttctgtgtctgtctgagtagtgagtgggagcctcgagaac
taaactgagcgcctggcgtcacgggccttcgctccaaaatggaagaaac