Description :
From Genome Similarity Track
Location :
Scaffold_62:3950- 5390
Transcript NameFunction/comments
Hyaar_Emoy2807283phospholipase D-like protein
Hyaar_Emoy2807284phospholipase D-like protein

Sequence
1440 bases(100 bases per row)
GGCTGCCACGTCAAACAGGTCCGCGCTTTCGAGAAATTTCATCTGGTTGATCTCGTCGTAGCTCCGCCCCGTCATCTCGTGAAATTTGCGTACACGGAAG
TCACGAACCAGTTTGCCCACCGTAATACCGTCAGGAGTATCGACCGTGTTCGAGTCGACGATGTTCGCGTTAAGCTCGGTGTCTGAAGTCATGCTGCGGC
TGTTCCAATTGGCTGAGCCGTCCGACAAGTACACGTCATCAATGATCACAACCTTGCTGTGCACGTACACGTGCAGCTTTGGCTTCATCGAGTACATGCG
AATCTTGTCAGGATATTTGTCTTTAATCGGCTTGACAAGCTTGTACATGTACTTCTCATACCCGCTGCTCTTTGTCATGAGATCCGGGGGCTGAACGACG
ACGATCAGACGCTTAATGATTGGCATGACCGCCAGTAGGGCTTCCAGCAACTCCGGCACGTAGATGAAGTACTGGTCCTCGACATAGATGAAGTTCTTGG
CGTTCCTGATGGCCTTGACGCGTGCATGGAGCAGTGATGTCTCACCAGACGGTGCAAACTCGTAATGTTTGTACGTGCAGCTATAGGTTCGCACAATCTG
CACACTCTGGTTTCCAAGCGTCGAGGTGGTATTACTACTGCTGTAGTTCAGCGCTGGCAAAAAAGAGTACTGCGGGTTTTTGAATGACACGACGTTGTCG
ACAAGATCTTGGCACGGCACGAACAGCGAGTTCCATCGAGCCAGGAAATTCGCTGCAACATCTTTAGCAGCCGGCCCATGGATGCGCAAGCTGCTGTCGA
CCCATCCCTTGTAGTCCAGATTGATACCGGCTTTTTCGCGAAGAGCTGACTCGTTGTGATAGATGGTGTCCCACCGGTCATTAGTAATATCGATGCCGCC
GACATAAGCCACCGGGAACTCTTCAGGGTCGGAAGAGACACTTGCAGCAATGACAACCGTCTTTTGATGATGTGACGAGATGCCCATGGGAAGCCGGTCG
TCAAAAATCAACTGTGCATTTCCATCGTTGAGGCCAGACTTCGGAAGTGAGTTGATCTTGTTGCGCACGATGATGTCTTGTTTCGACGGAAACTTGGTCG
CCCAGCAGAGGATCTTCACATCCCCTCCTCGCTTAATGACATTGCCAAAGACAACGTCAAAGTTGCTCACAAGACCTTGCGGGTCTGTCTCAGGCTTGAA
AGGCATGAGGTCCGTGTTGTACGCGGTCACCAGGACGCGGTCCTTTTCCTTGGTCGCCGACAGGTCGTCGTAGAGCGAGTCGAAAAACTCCTTCGTCACT
GTGAACGTCTTCACATCGTTGCCAGTACTGTAGGTGGCCATGTCCGAGCGAGGTACACCACCTCGAGACACCGTGATCTCCTGCTCGGTGAGGAGCCAAT
CAGTTGCTGACAGGAGAGGCTGCTCAAAGGGTCGATAGCC