Description :
From Genome Similarity Track
Location :
Scaffold_2143:395- 3996
Transcript NameFunction/comments
Phyag_g12106DEAD/DEAH box RNA helicase, putative

Sequence
3601 bases(100 bases per row)
TTATCGTTACTGTCCTTGGCATCCCCCCGTTAATTTTCATGCTGCTGTGGATCATGCTGGATCGTCTGGAGGGCTGCACTGTCTTTTCTATCGTTAGCCA
CAGCACCAAACATGCCCACATCAGTCTCTCCAGTGTGGATGTCATTGGAAATGGGATGATAACTCTTTCGCTGTTAATCGTGAAGATCGTCGTGAGAAAG
CGCCAAACGCTTCGTGTAAGCCAgagatcgtcgacgatcGAGTGTGTGATCTACCGATGTGGCCTGAAACTCGAGCAAATGCAAGGGCCGGAAAGTGCTC
AGATTCGAAGAGCTCGATCAGCACAGTCAGCTGCAAAAAGGCATACTGCTACTGCATTGAATTCCAACCGAAGTGCTGTCCGTGAGCCtagcttggtcca
gcaaTTGATGTTCATTAACTTTCCCGACACGTTTGACGCAAACCATGTCTTACTCCCTCTACGAGTTGCAAGCAACAGTCTGGTGTTGTTGTACGGTATT
GGTGCCATCGGTATCATTCTGTCATATTCCACTCTCGTGTACGAATTTAGCGGTACCCAGTCCAGTATACTGTCCACACAAGCGGGGGGGGTGCATTATT
GTACGCTTGTTTTCGTGGTCCCATTTGTAGCTCTTTGCCAGCAAGAATTGCTCAAGCTTCTCGTCACGTCATttgatttcttcttctacgcCTTCCAAAT
CACGACAGCAACTTTGTCCATCTGCATTTTGTATAACTGGGAACATTCACGATGCCTGATGCTCTTCACATGGTGGATCTGGATGCTATGGGCACTTACT
TTGGATGCCCTCACTCCTGTGATGAGAGACAAACTGTGCTTTCAACCACGTATGGCAGGTCCTGTTGTTGCATTAGTGCTTCTGGGCCATATCACCGTCA
CTAGCCGCATTATCttcgttggcgatgaagaaatACATAACGCAGCACTTTATCAAGGAGTCGTCTGGAATCATCACCTTGTCGTTCGAGCCATGCCCTT
TTGTTTCAGTAGGGTCATAACGCTATCTCTCTGGTGCCCGCGTTTGATTTGGAGGTTAAGCACTGCATCCAAGTCCGAAGTTACAATCATTCGAGGAAGC
GTGTGCTACGACAACTACTTCGCAATGCAAGGGCGTCAGAGTTCACGTGGAGCAAAAAAAAACCTGGAAAAAGGCAGCAGTTGACATTTCGGCGTGGCCG
CGTTGAACCTGGCGGGCTGCCTGATCATAGAGTCCGGAATGGTCCCACATTGAAATCTCTCGCCGCAATTCAGCCTCAGGTGGAGGGGGTCTAAAAACGC
CATCAGCTAGAGAAATATTCGAGACTTGTCCATGAGATAATCGGGGTTTCAAATTCTCGCCAATAGGCGCATACCAGCCTCAGCGAGCTTGTAATTCACC
TTCATGGTCTTGCTTTCCATCGCTTATTTGTGTGGCTATTCCATTCCTTCCACTCCGAAGCTTGCGCCCCAATTTCGTCAACCAGTTGCTTCCTAATTCG
AAAAGCTCGCTTGGAATCATCGATCACAACTTCACTCAAGTGACTGCGCTTTTTGGCATTCTCTGAATGAATACTCTGATACACTTCACGCGGCACTGAT
ACTTTCGCTTGGCGCAATAAAAGGACAAGCTCCTTGAAAAGTGGACGGTCTTCCAGATTAAGAAGTGTAAGAGCATTCCCAGACacgtcatcaccaccac
gtccaaCCCGGCCAATAAGGTGAACGTAGTCTGTAATTTTCTTGGGGAAGTCATACACTGCCACATTCTCGACATTCAACAGATCCATACCTCGGCTCAG
CACGTTCGTGGATACAAGAACAGGGATCTCCAAGTTCACGAAGGCTTCAAGCAGCCTGAGTCTTTCCTGTTGGGTCTTTTCTGCGTGGATCGCCGCTGCA
CCGATACCACATCTTTTCTCGATTGCTTCAGCAAGCATCGCCGCGCCAATTTTTGACCTCACAAATACAAGCTACACCGGCACCAACAGATATTATCACC
AATTGAGTAATTGAAATGAACAAGCTCGCTATTAACATTTGTACGTACCGTGGATTCTTCGCCTTTTCCTTTTAAGAACGCAAACAATTCGTCCTTTTTC
GCTTTGTCTTCCGACCAACGAACTTGTTGTTGAACGCTCGGGTTCAGCGAGTAGCTCGGCTTCCTGGTGTTAGCATCGCCAGAAACCGCGATGCGGGTAT
ATGCTTGTTCGTCTTGAACTTTCAAAACCTGTCGTACCAATAATTCGACCTCCTCCGAAATTGTAGCACTGAAAAACAGCATTTGGACATGCTTACAACC
ATCCCCCTCTGATGTAGCCAGTAACGCCACAATTTGCGAAATTTGAGGTAGAAACCCAACATCCAGCATGACATCCACTTCATCAACTACACACGAGCGG
ATCATCGGCAGAATGGCATTATCATCGCTGTAGTTCGTGAGAATATCAAGAAATCGACCGGGAGTCGCCACAATCAGCTGAACTCCACCTTGCAGCCGAT
AACGCTGAGTTGGAACAGGAAATCCcccaaccagcagcgccgtcttcatATCAGCAATGCCCCGCATCAACAACTTGGCCACCGTTTCAATCTGAATCGC
CAGCTCTCGAACCGGAGccaacaccaacgccacAATTTTCTCTTTCTCTCCTTCCCACGCAAGCAAGATCTGCGCGATCGCTGGAATTAAATACGACACC
GTCTTCCCCGCCCCGGTCGGTGCACTCACCAACACCTaaaaaacacacacacacatatACACAAAATGTCATTTTTGACAATCACCACCAGGTAGAAATA
AGGGCGTACGTTATGCCCCTCTAACACACAAGGGATCGTCTGCATCTGCACGGGCGTCGGTCTCTCAAAGTCGTTGATGGTGAGATTGGTCAGCAATTCC
CGGGGCAATTGAGTGCCTTGGCCAAAGTCCACGAATGGTATCGGCCACTGGTTAACAGCTTCCGAGTCTGCTGATCCAGATGAGATGTTGATGTCCAATT
TCCGTCGAAGCTCCTCGGACCGTCTAATCTGTTGCTGGTTCTCTTGGATTTTACGCTTGTGTCTGGATATGCAGACGTCGCGGCACTCGAGACTGCAAAC
GTCCTCGTCAGTTGCGTCACACACGTACTCGCCATAGCGACCGCAGATCTACGATTGGGAGGTTTTAAACAGCAAAAAAAGTGGTAAGCTTAGACATTTA
GGTGCTTTTATATATTATACCGGCGTTCCTACCACGCATTTGGGCTCGCCAGGCTGAGGCTGTCGCTGAGCAGCACTGCGCTCGACTATGGATGAGGTGT
CCGCCATTTTTTTTCAAATAAAAACTATTGGAATAATAATTATGTGTGGTGCACCCTAGATTACTTCATGCTATTACTTCAATCGTAGCaagctggaggt
gcaggCGAGAATCgacatggtatattcaccaagaatgatctcgagagatctttgcgttcggactgggctacctatgaatgaaggcactaagccttgcact
ccccagcagcccgtttaccgagtgggctttcgtttgaggtccttctcagggtcccgctcccacgttggtttgaagaagtcgtcttacttgattcggtgtc
c