Description :
From Genome Similarity Track
Location :
Scaffold_146:395- 2566
Transcript NameFunction/comments
Hyaar_Emoy2811098myosin-like protein

Sequence
2171 bases(100 bases per row)
GCCACGCTCGACGACGAGCAGCAGTTTCCCATGGACGTCGACGACCTGACGCAGCTCATGGAGTTGACCGAGACGACGATCTTGACGACGCTCGACACGC
GGTTCCGGCGGCACAAGATTTACACCAACACGGGCGCGATTCTATTGGCTGTAAACCCGTTTTTGAAAATCCCAGGCCTCTATGGTCCCGACACGATGGC
CAAGTACTTGCAGGCGTGTGAAGGGCGCCACCCGCGCCTGAAAAGTAGCAGCAAAAGTAACAGTAACAGCAATGGCTCAAGGACTTGCCTGCCGCCACAT
ATTTATCAAGTTGCTGGAGAAGCATACAAAGCCATGATGTTGGGACTCCATGGGGCGTCGACGGTGAGTGACCAGAGCGTCCTTGTGAGTGGAGAAAGCG
GCAGTGGCAAGACAGAGAGCACCAAGTTCCTCATGGAGTACCTCGCTCAAGCAGGTGCTAATCTAGCAGCACCAGGAGAAGCTATGGACGATAGTACTGC
TGCTGCTTCAAGGGCCAAGTGTCCAGAAGGAATTGCTGCAAAAGTGCTGCAGACGAACATTTTGCTCGAGTCGTTTGGAAACGCGCGGACGCTCCGCAAT
GACAACTCGAGTCGCTTTGGCAAGTTTATTAAGCTTCACTTTACTAGTAGCGGCTGCCTCACGGGCGCGAGTATTCAGACGTATTTGCTTGAAAAAGTGC
GGCTCGTGTCACAGTCCAAGGGCGAGCGAAATTACCACATTTTCTACGAAGTTGCTATTGGCGCTGCGCCAGATGCACGCAAGCGATGGCACTTGGATCC
ACCTGCTGGCCACCATTTGCCTCTTGGAGACTACGGCGAGGTGACGGAGACCACGCGCCAGTTTTTGCACTATCGGTACTTGAATCAAAGCGAGTGCTAC
GAGCGTCGAGACGGTGTGAAGGACGCTGACATGTTTCGACGGGTGATGGACGCTATGGACATTGTCGGTTTTACCCCAGCCGAGCGCGCAGGTATTTTCG
ACGTCCTCGCGGCCCTCATGCACATTGGTAATTTATCTTTTGAGCATGACGAAAACAGCGACAGGCTAAGCCAGTCAGCAGGCCCTGGTGTCGGCAAGTC
TGACCTCGCACCTGGCTGTATTTGGTCTCGCGATGCAGCTGCTTCGCTCATGGCCGTTGATGCTACTAAACTGGAGCGTGCACTGAGTGTACGGCGGATT
CGTGCTGGCACTGACTTTGTGAGCATGAAGCTCTCTGCAGCTCAGGCGAACAACGCCCGCGATGCACTTGCCAAGGCGTTGTACGGTCGTCTGTTTGATT
GGATGGTGACGAAGATCAATCACTTTTTAAAGATGGACGATAGCCAGAAGGCCAAAGGCGGCCTCCACTTTATCGGCATCCTTGACATTTTTGGCTTCGA
GGTCTTCCCGAAGAACTCGTTCGAGCAGCTATGTATCAACTTTGCCAACGAGACGCTGCAGCAGCAGTTCAACGACTATGTGTTCAAGAGCGAGCAGCGT
GAGTATGAATCGCAGGGTGTTGACTGGAAGTACATTGAGTTTTGCGACAATCAGGATTGTGTGAGCTTAATCTCTCAGCGGCCGACCGGCATTCTCTCGC
TCATTGATGAAGAGTGTGTGATGCCTAAGGGGAGTGACATGACGCTAGCATCGAAGCTGTACCGAGCGTGTGGTAGCCATCCGCGGTTCGAGGCATCTCG
TATTCAGCAGGCGCGTGGTCAATTTACGATTGTGCACTATGCAGGCCATGTCGAATACTCGTCAGATGGATTTTTAGAGAAAAACAAAGATGTCCTTCAC
CAAGAGGCAGTGGATATGCTCGTGTATTCTACACGAGAAGACAGCTTTGCTCGTACGTTGTGTGAGGGTATTGGTGGCTCGCTTGATCGTAGCAAGTCAT
CTCTACGTCAACGGGCACAGACTAGCAAGAACCGCGGCGCGAGCGTCGGCGTGCAGTTCAAGGAGCAGCTGACGACCTTGCTGGAGACGCTGCAGCAAAC
AAATCCACATTATGTGCGTTGTCTCAAACCAAACGAGTTATGTAAGGCAGGTATTTACGAGCGCGACGGTGTCTTGAAGCAACTGCGCTGCAATGGCGTG
ATGGAGGCGGTTCGTGTGGCAAGAGCAGGATACCCGGTCCGTATATCGCACGATGACTTTGTCGCGCGCTA