Description :
From Genome Similarity Track
Location :
Scaffold_2959:395- 2018
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_2959-snap-gene-0.1Eukaryotic translation initiation factor 3 subunit
Pytul_var.sporangiiferummaker-pug3_contig_2959-snap-gene-0.2Eukaryotic translation initiation factor 3 subunit

Sequence
1623 bases(100 bases per row)
CCAAAGATGCCATTCAGGATGCGCACTAGCACGTCACCCGGCGCGGCGCGCGTGGCCTCGTCGGCGTTCAGCACATCCGCGAGCAGGTGNNNNNNNNNNN
NNNNNNNNGCACGCGCGAGCATCTCCACTTCCAGCAGCTCGAGCGTGTACTTGGAGATGCCGCCAATGGACTCGAGCTTCTTGGCGAGCGACGCGATGCG
ACCCAAGTAGCGCATGTTGATACCGCACGAGTGCATCAACTCGGTGAGCGCAAAGCCGTCAGCAGGCGAGATCGCGCCGCGACGGACGTCCGACACGAAC
GCTGGGATCACGACGTTCTGCAGGTACGCAGCGGCGTCATTCGCGACTTCTTCGTCGGCTTTGGCCTCGCTCTCGTCGACGCACGCGTTGTACTTCATAA
ACACGTTCGGGTTCAAGCGCACAAGCGGGATGTCCTCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGTCTTCCTTTTCGGCAGCCT
CGCCTTCTGGCTTGGCTTCTTCCGTCGTAGCGTTCTCGCTCTTCTTCGCCGCCTTCAGCGCCTCACGCGCTTCCTTGCGCGCCTGGTTCTGCTTCCAGAG
CGCGTACAGCTGCACGAGTTCAGGACGCAGCAGCGCGACGTAGCCTTCGTCCTCGCGGTGGAAGCGCAGTCCCTCCTTGTCCTCGACAACNNNNNNNNNN
CCTCTTCTGGCTTCTGCTCCTTGCTGTTGGCGTAGTACGTCGCGTCCTTCGGCGTGATGCGCACAAGATCCAGCACGTACATGCGGCCATCCGAGCCCAA
GATGCCCTTGGCTTCAACAGGGCCACAGAGCTTCACGACCTCCGTGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTGCAGCGTCTTCTTCAGTCAC
CGCTTCCTCGCTCTCGTCCTTGCCAAGCGGCTGGATGCTGCGCTCAGCAATGTGGAGCTTCTCGCCAGCCTGGATCATGAGCGCGTGCATCTTGTCGTTC
GACGCGATCGTCTTGCCGCCGTCCACGGAGCCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNACGACTGTTGTCGCGAGCGTGTGGAGGCCCGGGATGTCCGCCTCGTTGAACGCCTTGACACCCTGCAAGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCCGCGGCGTCCTTAGGCGTGACCTTGC
CGTCGATGGAAAGTGAGAAGAAGATGTTGTTGAACACGTACACGTGCGCGCTCGCATCGTCCATCGGGTTGATCGGTGGGATGTGGCCCTCCACNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGCGGCAGCACTGGTACT
CCTCGTTCCAGTCGCGGAGCACACCGCGCTCGTCCATGCCGAAGGACGCCGTGAGTTCATCCTCAGCGCGGTTCAGGTCGTACGTGTGCTTTGGCGCATT
CGGCACCAGCGGCGTGTTCCACG