Description :
From Genome Similarity Track
Location :
Scaffold_3853:395- 1562
Sequence
1167 bases(100 bases per row)
CATCGCAGCAAAATCTACCTCTCTTAATTCATACAACACCGCGGCAAACAGGGCGTAATCTTCGATAAACCGACTGTAGTAGTTCAAACTGCCCAAGAAG
GATTGCATCGCTCGTAACGACTGTGGGAAGGACAAATCGGCTAATGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAACTCGATGGCCCA
AGTAATCCACCTTGCGCATCCCCCAATAGCTCTTAACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCGCACAA
CTGATCCCACGATTCCGCCGGGATCAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGACGGGGTCCCAGGATCCCCTGGCTCCCCCGCTTCGAAT
GGATCCACTTCTGCGTCACCTTCCCCGGATCCACCCGTTTTGGGCTCCGGTATTCGGGTGAACCCATAGAGGGCGTTATCGATGAGGCGTTGGTAGATCT
GGGGTGCGTTCTTCAATCCAAACGGCATCCGGGTCCACTCGAACAGGCCAAACGGCGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAAC
CACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCCAGATCTTCCAACAGTTCATTGATTAGAGGCATCGGGTACACCATCAAT
CGAGTCAGGCTGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACCGGAGATGCCCACGGGGACGTTG
AGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGACAGTTTTTCTCGGAACTGAGGTGCCACCTTCCGCACCCTTTGAGCGATCGGTTT
CGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCGGCGGGCGGTAACGCATTACCCTTACCGATCAGCAGATGTCGGCTTTCCCAGATCTTCTGA
CGCAGACGATCCACTTCAGTGGGTTCGTTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATTACCG
CCATACCTTCTCCAAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGTTCATCTTC