Description :
From Genome Similarity Track
Location :
scaffold_25:394971- 397403
Transcript NameFunction/comments
Plaha_PHALS_13692hypothetical protein

Sequence
2432 bases(100 bases per row)
TTGGCACGGTTGCCGGCGATGAAAGAGCAGATACAGCTAGAGAAAGCCACTTATGATGACTTCCTTCACAACCTCAAGTGTAATGATATTGCGGAGGACG
TGTTGCTACGGCCGAATGTCGACGCAGCGAGACTACGCTCATCATCGGTTTGGATGATTCGGTTCTCGAAAAATTTCGCAGCATGTGGAGTTAACATTGA
AGGAACAAACTGATCCTTCCTATTCACTTGTTATGGAATATAAGGATGACGTCCTTAGTGCGAACCCGCCCTCTGGTCTTCTACCCGAACAAGGAGTTCT
CCAATAAATTTATCGTGAAACTGGTTCAACGCGTGCAATGTTTTGAAACTGGCCAATGTCGCGTGACCAAAGTGAATACATCCATGCGttttttgctcaa
aagcaagctgctTAATTAGTGAGGGAGAGCAAGTCCACTCATATCGCACCGACGTTCAGTGCGCGTAAACAATTGGTTAatggcgtattgttcacgcCTA
TAATAAGTTGAATGCGATGACGATTCTCGCACAAACGCCGATCCGGCTCAAAAATGTCATTATCCACCGGGTGTCCAGCTGTACGCAGTTCAGTGTACTA
GATTTGTTCCATGGAAATTACCAAATCGTGATGAGGGAGGAGGATGTCTCTTTGACGGCTGTTACCATATCGTCCGGTATATTATTtgagtggcttgtga
tgccacaGAAATTATCCAGCACCCCAGCAAGGTTCAATCGATTGGTATACATCAGTAGCGACCATTGCAACGCTTCGCACAATCCTACTTGACGATATAT
GTGTCCATTTGGAAGATGGCAGATCTGCCAAAAAATGCACTTGGAACACTTCTGTGCGTTACTGGAAAGTAAGCGTGAACATTTATTGCAAGCGAAACAT
GCAAAATGTATTTTCGGTGCCAATGAAGTAACGTTTCTCGGTCGTTATGTTGCTAAACACGGTGGTTGGATAAGATCAAAGCAATCAGGGAGTGATCGAC
GCTACGAAATCATAGAGATTTGAGAAAGTGGATTACTAAgtccaattacttgcattgCTTCTCGAGTAACAACGCCGCGGTGGTCCGCTTGctatcaaac
ttgctgaaatAGGACGTACCTTGGGAGCGGTCATCCACTTGTGCAGAAGCATTTACTCAGATCATGAATAACTTGATGAAAGTACCACTGCATGCATTAC
CAGATGATGCGAAGCCGTATAACGTGTTGTGAGATGcttctgagtttgcaatcggtTGTGCATTATTGTAAAAGGACTCAGAAGGACGCGATGGTATCGT
GTCGTTTCAGTTGCAACGGCTGAAGCCAGCAGAATGGAACAAGCCTGTCCGCGACAAGGACCTTTTAGCAAATGGGTTCAACTCCGTTGGACGACTACAC
GATTCACCAAGCTTGAATTATCCGGTTCAGTCGCCGTACTTGTCACAGCGAATGGCTCGCTGgttgtcattctttgcagaagacAACTCCCCGGTCGCGT
AAACGTCAGGGAAACTAAATGGTGCTGACATACGAATTGTCGCGTCGTCCtgattatgagctagctcatatcaGTGATATTTAAAGTAATGCATTCGATA
CGCTACACCGAGCGTATGTTGAAGATGAATAgtgtgatctgatcatcagaGGATTATCATCGAGTGATATGAAATCCCATGACAAAATTTTCGATCGCTT
GGAGTCAAGTTTGCATCTTTATTGCATGAGATGATGGTTTCCTTTACAACTAAGTCGCACGTGACGACTGCCACGGATTGTGGTTTCCCACAACGATGAT
TTTGAAGTACAAAATAGTGCTCGAGATGCTTGATACGCCGTTTGCTGGTCTTTTTGGCCGTAAGAAGACCTGCCAATCGCTCAGTGGCCAATTTCGGTGA
CACCATATGTACAAGTGAGTGGCACATAAAGTGAAGACGCGCGATGTCTATCAGCGCGTGAAAAGCGCATGGTAGGTAGTCTTCCTGTTCCTACTGATAT
TTGCAGTCAGTCCGTCTCGACTTTATTTTTGGCTTCCCGGGAATGCTGACGGCAACCATTGGGGTACTCGTCCTTGTTGATTGAATCAGTTCGATGGTTT
GCATCGCACCGTTTAGCGATTCTATTAATGACGAGGGTTCGAATTGATTTTTCATTGATCATGTGTTTCGCAATCACGGGATgccagacgccatcgtctC
ATATCGAAACACACGATTTAAGATTGTTTTTTTAGACTAGCTTGGATATGTCTATGGCGGTAGAACCGGAGACCATGGGCAAACAAAACGTTCCAATCGA
GTGATCGGTGATGTGTTGAGACGTTTGTGCGAAAAAGTCCGCGGAATAGAGCTCGTTATTATCATAAGCTGAGTTTGCTATGAACAATTTAGTTCATTCA
TCCAATGAATTTACGTCTTTCTTTATGAATGG