Description :
From Genome Similarity Track
Location :
Scaffold_48:39492- 41174
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_09710small nuclear ribonucleoprotein Sm D1
Sappa_CBS223.65SPRG_09711Os12g0209100

Sequence
1682 bases(100 bases per row)
CAGCGCGGCAATCGCGACGCGAGCGTACTCTGTCGGGACATGCACCACGCGGACGAATGGCCAGTGGTCGGCGAGGTCGACGACAGCGCCGAGGTCGCGG
AGCGCTGCGAGGTCGGGCGGCAGCGTTTCGTCTGGCAGCGCGGCCAGAAAGGCAGCCACGTCCCGTCCGTTCTCCATGGCCTGCAGGATAGCATAGACCA
CGACGCTTGGCAGGCTCGGCGAAGTCGCGGAAAGGTGCATGTCGACCGTGTTGGCCTCGATCGCGTCGTCGGTCGTTGCCATCGGCTCGGATTGAAATGC
TTGCACTGTCACACATGATACCCGTCGAACTATGTAGCCTGCCAAAATCCATGTCCAGCGTCCCAAGCGCAGCCCGTCGCGTCCGGTCAAAAGCGCCAAC
GTGCAGCGACAGCTACGCGTGCGGTAGGGTCTTACCTGGTATACTTGAAGCCTCGCATGGGAGTTGCCACGTCGGATCTGAATTTCAAAACAAATCTCAA
AATGGGTTTTTAAAAGAGATTATGGCGATCGTCGCGCCTTTCCAAGATCCAAACCGGTCTATGCTCGGACGTACTAGTAGCTCAGATGCTGGGCTTTCGA
GCATGCATTCGTACGTGCTTGGTACCGATGCTGCTAGGAGGGTCATGAAGGGTGCGCTGGTGACGTGGCGAGCGACGTAGGGTATCTTGTGTCGCCGTCG
CCTCCTGGCCTCACGCTCGGCTCAGGTCACGTCCACGATACAGCAGCTGGCATGGGCTCGACGAAAGTGACAGCGTCGACAAGCGGCAACGCGGTATCGC
TCGCTACGCATCGCAGGCGACGGTGACCAAGGCGCTCGATCCCGCGATCTCGAGATGTCAACGCTTATACATAACACGATGGATTAGAAGGGGCATAGTC
GCGCATACGATTACGGGCGGCCGCGCCCACGACCGCGCCCACGGCCTCGGCCGCGGCCCTTGGCGGCCATTGCGCCGGCCCCCGTGGCCTTGACCTTTTG
CTTGGGCGTGTCGTCAATGAGGAGTGTGTCGAGGTTGAGCGAGTCGGGCAAAATGTAGCAGCGGATGTTGTTGCCACGGATGCTCAGCGAGTCGAGCGAC
GTCGGGTTCTTGCCCTTGACCGTCATCTTGACGGCCTTCAGGTGCGTGTTCATGCTAATGTCGACGCCTGTGACCGTGCCATGCACGACCGTCCCGTTCT
TGAGCTCGATGGTCACCGTCTCGTTCGAGAGCTTCATGAGGAACCTATGCCATCGCGCCATCATGAGCATAACCCTTCATGGTAAGGCCATGGGCGCGGG
CGGCCACCGCGCCGCCCTGCCCATGCCCCGTGGCCGCATACCGGACGAGCTTCATGCTGCCTGTGTTGCGCTTTCGACCACTGATGAAGATGGAAGCCGA
GGCCCTCGATACAAGCACTCGCCGACAATCTAGTAGCGAGGGCTTCGACATCCGGATACAGGCGCCCCGTATCCGGTATTTCTATCCGGATGGGTTGCGG
CCAGTGGTTCTTATTGCCAATCGCGGAAGAGCAGGAGGAAGTCGACGACATGGGCCGCGCTCGCAAGATCATCAAGAACGTCATCACGCACACGCGGGGC
ATGGTCCGCAACCGTGGCATGGAGGCGCCCGAGTGGCTCGAGATGGTCAACCGCTTCCCGCCGCCGGCCATGCCCCGGACCG