Description :
From Genome Similarity Track
Location :
Scaffold_14:39491- 40879
Transcript NameFunction/comments
Physo_131007hypothetical protein

Sequence
1388 bases(100 bases per row)
GTCGTACTCTGCGAGGATCTCCTCGGCCGACTTGCCCGACGTCTCCGGCACGAGCTTGAGGCCCAGCAGGAAGAAGACGGCCAGCAGCACCACGAACGGC
ACGTACGCGTAGTCGCCCAGCGCGTCCGAGATGTACGGGTAGGCCACGCCCACGATGAGGTTGCAGAGCCAGTTGATCCCGATGCAGAGCGACGACGCGT
GGGCTCGGATCGAATCTGGGAAGATGTCGGCTGTCATGACCCACACGAGCGGTCCCAGCGTCACGCCGAACGCGATCACGTAGAGCGCCGTGAAGACGAT
GGACAGCGCCGACACGTTGATGACGAACGCCACGGTCATGAGCACGGCCATGACGAACATGCCGCCGAGGCCCCAGAGGATCATGTTGCGCGCGCCGAAG
CGGTTGGCCATGACGCCCGTGAAGAAGGCGGGCCAGATGTTGATGAAGTCGATGATGAGCGTGCCGATGCGCGAGTCCGAGATGCCCGCCGACTTGAAGA
TGGAGCCCGAGTAGTAGAAGACGGCGTTGATGCCCGAGAGCTGCTGCGCGCACGAGAGCAGGATGCCACACGCCATCTGCATGCGGTAGCGAGGGGCAAA
CATGGACTCCTTCTTGGGGGCGTCGCTGGCCTCCTCAACGGCGTCCGGATTCTTGTTGACCTCGAGCCACGACATGGCCGTGGCCACGTGCTCCTCGCCG
TAGAGGCGAGCGATGACCTGCTTGGCCTCCTCCGTTCGGCCCTTGGTCAGCAGCCACGCCGGACTCTCGATGCAGAACTTGGGGGCCAGCACCAGATAGA
TCACGGCGAGGATGCACGGGAAGACCGCCAGGTAGCGCCAGCTCGTGTTGGTGAAGAAGAAGGTGATGGCCGGGAACAAGATGCCGATGGTCGTGAAGAT
CTGCAGCCCCAGGCCCAGCATGTTGCGCATGTGCGGAGGCGAGAGCTCGTTCACGTACGCGCCGATGGTGCCCGTGGCCGTGCCTGAGGCCAGGCCCGAG
ATCAAGCGGCCCGCGGCGAAGGCCCAAATGTTGGACACCGACGCCTGCACTACACCACCCACGAACATGAAGACGCAATTGCCCATGAGCGCCTTCTTGC
GGCCGTACTTGTCGCTGAAGTAGCCGCAGCAGAGTGAGCCGATCATGGCGCCGAAGATCCACGCGTTCACGGCGAACGTCCACTGCACCTTGGAGTGGCC
AGGGAACATGAGGCACGTGAACTCGGCCACAGGGCGCGCGTCGCACTGGTCTTCGTCGTTGTACTGCGACAGGTTGGTCTGCGAGGTGGACCAGCCGCTC
TGGAAGGGCTACAACCACGACAGGAACGCCGTCGTGTACAGGATCGCCTTGGGCTTGATCAGACGCGCGGCCGCCTTGTTGGCCTCGT