Description :
From Genome Similarity Track
Location :
Scaffold_109:3949- 5861
Transcript NameFunction/comments
Phyta_totarag3755hypothetical protein

Sequence
1912 bases(100 bases per row)
TGGTGTCCTGCGTGAATTGGAGCCTGTTGTAATGCCTCATGTTGTATAGCAGCACTATCGGCTCTGCTTGGTCTGTCAATGTTCGTTTGCACGTCTCTTG
GAGTGATTGAACCCATCCTCCAGGCTGCCCCACATTAAAATTGCGCTCTTTCACTGACGTGAACAGCTCCCCTCCACAGTCAACTTCGGCAGGCTGGAAG
ATTTGGTAACTGGCTGCCGGTAGGCTTTCTGGggcaacgacgacaaagATGTCCCGATGGAGTATCTTTGCCAACATTCTCAGCGTTTCCTCGCTTCCCC
AGTAACGGCGATCCATGTAAGCAGCGTGCTTTGACGAAGTACTGCTAATGGCATGCAAGTAGTCCTTTACAGCTTGAGCCGTTTGTGTCTCCGTCAgacg
ttcttcttggtcggCTAGTTCATCATCCAGTGAGCACAGAATTGCCTCTCGAATGTCATGAGGGAACTCTTCCTCGAAAAAGTGGTTCACCGCCGTCCAT
AGCCCCTTTTTTCAGCTTCGAAGTCATTTTTTCAAGGGCAGTCACGCTGGCTTTGTCGTCGAAGGATCTGTTTAACAGTGACATCGCGATGGAATAGTAC
TGACAGCTCCCTGTGGGGGCGTCGGTACTGACTGTAGTCCGCAGTCCTTAAGCACCTGTTCCCCGGAAATGCCCTTCTCCTCCGGGTGCGGGGTGGTGAG
TGCTGTACATTGCGACATCGCGACATTGCGACATTGCGGTGGGCGCTTGCGGTCGGTGTTTTGAATTGATGAGTTGCTCAATCTGCCGTTGGTGCTTGTC
CATCGCAGCCATTTTCTGGCGGTGTTTCCCCTTGATCGCTTCCGAGATTGACATTCCCTCACTTACTTTAGCCGGCTTCAGCGGCACAGGTGTCGTTTCC
ATGCGCTCGTTTGCTGATGCCTCCTCCGTCCGGGTTAAGCTCTTTTTTACTTTCGACCAGAGCTGTTTGGCATCGCGAGGTGATCCAGCTGTGCGCTATT
CTCCGTCCGGTTTATTCTTCCCTATTTGGTTTACTTCTGTTTGAGGTGACGTCGCTGTCTCTGCTTTCGGTCCTTGCATTAGCTGGATGCTGATCTTTGG
TGAGGTGCCAGTCTTGATAGGTAGCTGGGGCATTTCTTGTTCGTCGATCCAGTATTtgttgagctcgtccagacTTGTGATCGTGCTTGCTTGTTGCGGC
AGCTCCGCGATGGTACCTGGACACAATAATGTGTTCTCCAATACGCATCCGGCGCATTGCATTGGTTCCGAGTATGCCCGCTGGCTCCGCATTTAAAGTA
CGGTGGCGCCCGTGAACGGTTTGTATGGTGTATTAGGATTTTTCTTCCCGCCCAATCGATAAAGCGTTTGTCCTACCGGAAATCTGGACAGAGTGAGCTC
TTGAAGTACACGCCCCATGTATCCGTCTGGAGGGTACGAGATTTCGTTGACGGCTCTTGCCATGTTGTGTAGCTACATCCAAATTGTTGTTGGATAAAAC
ATCCAGTGCCGCCTCGTCCAGAAAGCGGGACACATTAAGAAGGCGAACTTGGTATCTTTCTCGCTGATGTTCGTTTCAGGCACCATCCACTCCAACTTGA
CGAGCCCACATCGATGCTGCGCGCGTTGTCGTGTCCATCGACTCTGTGCTCACTTCAGGGTGTTCGTTCTGGAGTGGAAAACGTCTACTCCGGAACGGTA
GTGAGTGGAAAACTTGACCCCACTTGGTAGCTAGTTCTCTGGTCCAGAATCTCAAATGTACAGCGTGACGTCCTTCGTCGTAACAGACTTGCTTGGTATC
GCGAAGCATGGCTACCACGTGGAATTTGTCatagccccccccccccccccccttgtGACTTCAAGCAAGATCATGCCAACCAGTCTTTCCCGAGTCTGAA
AGTCGGGGTAGA