Description :
From Genome Similarity Track
Location :
Scaffold_121:39489- 40863
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_121-fgenesh-gene-0.7Mitochondrial-processing peptidase subunit alpha

Sequence
1374 bases(100 bases per row)
CCAACATGCTCGCGCGCTCCTCCGTCTCGATCGCGCGCAAGAGCGTCGCGCGCTCGTTCTTCAACTCGGCCAATGTCGCGAACCAGGTAGCCGTGGACGA
GGAGTTCCCAGGCCTCCCGGCGACCCACCCGGCCGCGCCAAAGGCCGGCAAGACCGAGGTCTCGGTCACCGGCTCGGGCATCAAGATCGCGTCCAACAAC
ACTGACCCGTTCGTGACCACGCTCGGCGTGCAGCTCGCCGCCGGCTCCCGCGTGGAGACCGACGAGACCGCGGGCCTCTCGCAGCTCTTCGCCAAGATGG
CGTTCCGCGCCACTGACGCGCGCTCGGACCTGCGCTTGTTCCGTGACATTGAAGCCATCGGCGGTGTCATCAACAAGGAGGCCGNNNNNNNNNNNNNNNN
NNNNNNNCGACTTTGTGCGCTACACGATCAGTGTGCTGCCAGACCACACTGAGGCTGCTGCGCAGATCCTCGCCGAGACCACGCTGGCGCCACGCTTCGC
GCACTGGGACATTGCCACCCAGAAGGAGCAGGTCAAGGTCGAGTTGGAGAAGATCGCCTCCAACCCTGCTGAGCTTGTCCTGGAAGGCGTGTACGCCGCC
GCGTTCTACGACGATGTCACCCTCGGCCGCCCAGTCGTCTCGACCGAGAACCTCGCCAAGTACGACACCGAAGACCTGTGGAAGTTCTATGAGACGTACG
TGAACACTGCCGGCGCCGCGCTGATCGGCTCGGGCATTGAACACAGCGACTTGGCCAACATCGCGAACGAGTACTTCAGCGAGCTGCCAGTTGGTGCGCC
AATCAACCGCACCCCGGCCAAGTACGTCGGTGGTGAGTCCCGCGTCAAGACCTCGTCGCCAGTGACCCACGTCGCTCTCGGCTTCGAGACCGTCGGCAAG
CACGACGCTCTCTACGGCTCAGCCAACGTGTTCCGCGCGTTGTTGGCCGGTCGCCTGAACCCAAAGCAGGCGTCTGCTTTCTTCGCCAGCCACGGCGACG
CCGGTGTGCTCGGTTTCTCCGGCCACGCCGCGAACGCGGACGTCGGTGCGCTCGTGGACTCGTTCATCGCGGAGATCAAGAGCCTCGCGACCACCCCAGT
GTCGGCGGAAGAGCTCGCGGTCGCCAAGACCGTCACGGCTCTGAAGGCCTACAGCTCCATTAACACCCGTCAAGGCATGGTCGAGCGTCTGGGTCTGTTG
GGCGTGGCCCAGGTGCCAGTGCCATCCCCATCCAGCCTCGTGGACTCTGCGACGCCAAAGTCGATCCAGGAATTGGCACAGAAGGCTTTGGCTTCGCGAC
CATCTGTGGCTTCGATCGGTAAAGTCTCGGCTGTGCCTCGCGTGGAAGCCGTGCTCGCCAAGTTGAAGTAAGTA