Description :
From Genome Similarity Track
Location :
Scaffold_147:39487- 41071
Sequence
1584 bases(100 bases per row)
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnagaccgtcgatcacgaccgcatgctgctgacgagcatcctggagctgactttcgaggtttgcaatccgtacccgatcac
cctcatggctggctagcgcatcgacaacctccccaaactgccgcctggagtcgttcaagtcttgccggatgaggtcgtaccggtgttgacagtactgaac
gaacggagaggccaggcgagcggcttcgctgaactggtgctccaagctttgaatatggtcttcggcagatcgaagctgcccctggagattggcgtaatcc
agcctaagctgttggaatgcaccctctctttccaaagccacctcaatggctgcgagacttgatcggagcgtcgaggcatctagtggaggaggtccaacat
tggcgttggccaacggaacgcgccgtcgatcagaccgaatataggacgatcgaaagctggatgatcgggcagacccaggagctgtggtagacgcacgatc
aggactggaaccacccgcacgatcacgatcaggactggaaccacccgcacgatcacgatctggactggaaccacccgcacgatcacgatctggactggaa
ccacccgcacgatcacgatcaggactggaaccacccgcacgatcacgatctggactggaaccgcccgtacgatcacgagtccggttgatcctacagccgg
aaatggctagaagtccagccacagcgtcttgacgatcaggaatccctggagatggcggagcacgcgtacttgcagaggtggacggcggtgattcggtggt
ggaagcggacgtaggacggtgagggtcacggtccgacacggtgtgtccagcttgctggtcgcggggccccgccgaacctgtggaagaggacatgtcagtg
ggacgaaggcagggacgaaggcaatgggcaggaagggagaagctcacctgcatgttcgggactgtgccgcccggcaggagcagcagcaggaccagcaggg
cgacggcctctagtctccgtcggatctgtgccaccggaacgttagtgggagcactacatgatgaaagatacaacggcgtaccagtattgcgaagaggggt
gccttcgggcgatggagacgcggggaagaactcatttctgcaggggatacgtcgaacggggaaggagtgcgagtgtgggccgat