Description :
From Genome Similarity Track
Location :
Scaffold_9:39484- 41759
Transcript NameFunction/comments
Phyci_77357conserved hypothetical protein

Sequence
2275 bases(100 bases per row)
CTCGCGAACAATCTCCTCGGGGTGCTGGAGTCGGGGTCGGATGGCGGACTAGAGCTTTTGAAACGCCCAAACGCAAGTGGGGAGACTTTGCTGCATTCAT
TAGCCAAAACACGACAGAAAGGCTTCGACGCACTCGCCAAGAAGTTAGCATGGGCTCTCGTGGATGCTGGTGTCCATGTGGATGCAGAAGACAAAAGAGG
AAACTTGGCATTTCACTACGCAGCGAAGCGTGGCAATATTCACTTGCTGGATTTCCTACACCATCAAAGAGGTGGTGCAAATACCGAGAACATGAAAAAC
CACGCTGGTGAGACCCCAATATTATTTTCTCTGAAGCAGAAGAGCAACCGCAACAGTCTCAGCGACGACAATTTGCTCACTGTGCTATGCTATTTCTTGG
AGCATCCGTCGTACTCGCTGGAAGTCCACGAAGTTGACAACTCGGGGATGAACGTGCTCGGCGCATTTGTTGACCGCTTTACCGAAAGCCTTGCTGCATC
GAAACCAGTGCTGTTCTTCACGATGTTCGAGACGTTGCTTAAGCGCGGTGTGGACCCCAATCTAAGCTTCCATAGTGCACGCGCAGCAGCGCTAGAACGA
AGGAAGTTCCCAAGCAAACCTGATGATAAAGACCAATTGCTACGATCTGGCCGTGACCTCTGTGAGATCACATCCCTCGCAGAAGGGGATAGTGACAAAA
TGCCAGCACTCGTGCGTGTCGCTCTTACGCCAGAAACGTCCACACGCTTCCATTCAATAGCACTCTTGCTCCGATATGGTGCGAAACTATCCACAACTGA
TGGCAGGGGGAACACACTGCTAATGCATCTTGCCGCACGAAATTTGGTTGCCGAGACACGTCTCGCACTCGGACTGATTCGCTCAATACCAGAACCGAGA
GACGTGTTCACATTCGCGGCTTCGAACCGCGTGTGCGCGCTTCATGTTCCAGAAGCGAGCGTGAAAGAAGCACTCGGGCAGCGTAACACTACTGGGTTAA
CGGTGTGCCATATCGCTGTAAAACCACTTGACTACGGATCCTACGAGAACACACGCTTGTTGGCAATGCTCGTCCGAGCTGGTGGTGACTTGCGCATCAG
AGACGCTTCTGGAAAATCAGTTATCGACTACGCACGGGACCAACGCTCGCACTTCGTGTTGCGGTTCCTCGAGCGCACGTTCCCAGATTTCGTGACGGTT
CAAGTGGCAGACTCAGAGCCCAGCACTGTTTTTGCAGCTGCACCGGCCTACTCCGATGATTCTGGCGCGTATCTGGAGGAATGTGAGACGTCGGGCAAGA
TAACGCGTTCGCTTGTCATACCCAAAGTGAACGCGAGCTGCGATGTCGGTAAGGTGAGTAAGGTTCACCACGACAGCGGGGGTGCAGAATTGGATGCGCT
ACTCACCAAAGTGGATGTGAAAAACGGGCGTTTCGGGCTCAACGTTTTCTATCGTCTGCAACTAGTGCACGACGAACTGCAGGACATATTTGTGCTCTTC
ACAAACTGGGGGCGGATTGGTGAGACGGGCAAGTTCCAGAATACGCCGTTCCGAGATGAAGCGGAAGCTGTGACCGAGTTCAAGAAGATATTTCGTAGTA
AGACCGGCAATACGTGGGAGTCGCGTACGCCAGACGAATTCGTCAAAAAGCCCAAGAAGTACAACCTGGTCCAGCGTGTCAACCACGAAACGAAGGTGGA
TGACGAAGTAACCCGATCATTTCGCGAGGACTTGGATGGCGGAGCGAGTAAAGGTTTTGTGTTTCCTGAGCCCCGCGACCCGGACTTGGTGGGGTGCCCT
AATGTCATGGCGATGCTAGCGGCAATCACCGACGTGCGTAACCTGCAGCTTGCAGCCCAGACGAGTTGTGGCTTCGCCGGTGGTGATTTACCATTGGCGA
AGCAGGAAGAGTTGCATGTGGCGCTCGATAAACTTTACGAAATTCGTGGTTTACTGGAAGAAAAAGAGGATTTGGTCAAGGAAATTGGTACTGCCAGTGG
AGATCTGTCCGACGAAGGAGCTACAAAGCGTGCATTACTCGCGACACGCCACGAGGCACTGACCGAGAAGGTGAGCGAACGTAGCAGCCGTTACTACGAG
ATCATGCCATGCCAAGAGGATATGCTGGCGTCTTCGATCAAGGCCTTCGATCAGGTGAGCGATGTGAACGCAGAAATTACGCGGCTGCGGCTGCTGTCAG
ACATTATGGAGACGTACAAGATGCTGCTCGGAGCCAAACGGGCGCAACAAACAAAAAATCCGTTGGAATACTGCT