Description :
From Genome Similarity Track
Location :
Scaffold_159:39483- 48027
Sequence
8544 bases(100 bases per row)
CTTCCCTACTTTTCTTCTTGAGACTGCATCACGCCGAATCGGTTACGGTTCGTACGATCCCTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTG
CCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACGCCAGAAATTCACGGTAAACCCGTCCGTATCTAGTTCGTTTTCCCGACCTCATATCGGT
GATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGGACTTCGTCGAAGTCGACGCGATCGGATCCATCCACC
GAAAGACGGATCTGCGGCCGATCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACGGGGAACAGCCGATATTCGGTACCTGCCGTTTCTA
GCCTTACCGCGTGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGGGCGTACCCTTCTTTCACTCGATCCAAATA
AAGCCACACCCGCGATCCCACTTGGATTTGATGTGGACGGGCGTCTTAGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGTTCACC
TGGGATCTAGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTCGGATCTCGGTTTCTCTTCTTGGTGCTGCATACTGGGATGGGCCGCTTCC
AGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGTGTATCACCCCGGATCCTGTCTTGGGCAGTGTTCATCGCGAAGAGGAGCCGTTCTGCGT
ACTCATCCCAATCCCTTTGATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATCGTCTGCACCATGCGTTCGGCCGACCCGTTAGCTTGGGGACG
ATATGCCATGGTTGCTCGCTGTCGCTGCCCTAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGGTCATGTCTAATCATTTCG
CTAGCACCAAATCTTCGGAAAACACACTCCTCGTACGATTCCGCAATAGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCAATCACATATCCGGTAAACA
GGTCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGAATATGATCCATGGCTATGATCTGGAAAGGGTAAGTCGCTCGGAC
ATTCCCAGGTGACTCCCCTTCGATCGTAGGTCTGCCTTTGCCTGTCTCACAATCCACGCATTCACCGACATATCGTTGTACACTCTTGAATAGACCTCTC
CAATGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATGCCCTGATGTCCGCCTTCCAAGCTAGCGTGGTAGTGGTGTAGGACATCCTGTTGCAAGG
TTTCTGGCATCACCAATCTCATCAATCCATCCCGATCCTCGTGGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCGTTCAGATCCACTGCGTAATC
CGTAGCGATAACGCTGTAGGATTTGGCATCCTCCCGACTTAAGTCTCGTACATCCCCCATCAGATACATGAANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCCGCGCAGGGAGCCGAATTTTTCTTTTTTCCCACCGCCTCCGTAGTTCCAGCTCCTTTCGGCCTTCACGTTCCGGCTGGCAAAGGGAC
TGGATGACGAGTCCCCCTCATGGTCTTGCACCAGAGCTGCTGAGACTGCCCAGTTACTGCAATAAACTATTTCCCGTAGGTCGACGTTCCGGGATCGAAA
TGACGGAGGATAGGGCGTGGTCCGCGATCCTGTTCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCAAGTTCTGATCC
GTCGTCTCTATCCAGACTGGATCCTCTCTCTGTTGGTCTCAGAGTGGATCCAGCTCCTGTGTTAGGTCCTCTTCTGACGTCATACCACTTGGATCCCTTC
GTGGATCCGACATCTCCCGGGCCAGAGCTTGTTGGATTTTCATCTGGACAGCTGGAGCGGTCATCGCAGCAAAATCTACCTCTCTTAATTCATACAACAC
CGCGGCAAACAGGGCGTAATCTTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCTCGTAACGACTGTGGGAAGGACAAATCG
GCTAATGAAGACAGGTCCTTAGGATTCGCCTCTAATCCCTCCTTGGAAACTCGATGGCCCAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTAACCA
CACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCACACAACTGATCCCACGATTCCGCCGGGATCAGAATGTCGTCGAT
GTAAGATCTGCGTCCTAACACAGACGGGGTCCCAGGATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCTGCGTCACCTTCCCCGGATCCACCCGTT
TCGGGCTCCGGTATTCGGGTGAACCCATAGAGGGCGTTATCGATGAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGGTCCACT
CGAACAGGCCAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAGCAGTACCA
GAGTACTTTATCCAAATCTTCCAACAGCTCATTGATCAGAGGCATCGGATACACCATCAATCGAGTCAGGCTGTTAACCAGCCGGTAATCAATGCACAGA
CGTATATCCACCCCGTTCTTCTTGATGATGATTACCACCGGCGACGCCCACGGGGACGTTGAGAAGCTGATGATCCTGGCTTGCAGCAGGCCCTTAATCA
GATCCGACAGTTTTTCTCGGAACTGAGGTGCCACCTTCCGCACCCTTTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGC
GGCGGGCGGTAACGCATTACCCTTACCGATCAGCAGATGTCGGCTTTCCCAGATCTTCTGACGCAGACGATCCACTTCAGTGGGTTCGTTCGCCCCTGGA
CCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATTACCGCCATACCTTCTCCAAGATCCTCGGCGTGTAGATCCCCGC
CTTCACGGTAGCAGACTTGTTCATCTTCGGTCTTTGTCTGATCCACCCTTGGATCCAGGCACCGCGACTCTCCTTCGACCGTCATCCCTTCTGTCTTCGT
GGGGTCGGGTATCCTGGTACTGGGGAAGTCACCGGTCGGATCTAGCCGGTCCTCTAACGAGTCTGAACCCGACGGTTCGGGTTTGACTAGCGTTGCCGCT
CTCGATAGGGATCCAGGCACTTTATCCAGTGGAAAGCTTGGATCCACTTGTGGATCGGCGGGATCCGGCTGTTCGGCTTTAGCCCTCTGCAATCCTTCGT
CCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCCGTCATGGATCCAACCTTCATTGCTTGGATCTCAACCCGTCGATCTCTCTGCAG
GATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGAGATTCGATCTCGGTAGTCGCC
TCGTACACCAGATTCTGCCATTCTCTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCAACCATCGTCCGATCT
CCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTTGGATTACGGTAGGTACCCATTTCTC
GCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTCAACCGGTCTGACAGCTCCCAATTTTCCCCGGGCTCGATCCAGGTGGTCTTATCCGCCCTT
ATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGATCCAACCTCA
CTCCGGCTGGCACCATGAAATCCATCCCAAGGATGGCGTCTTGACCAGCGAGATCCCCGACCCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGT
GATCTTGATTCGCGTTCTCCCGTTTGTACGGTATACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGA
GCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGAAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACC
ACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACAGGATCCAGTGACCTGACA
GACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAATCATCGACCATGTTGGCGTTTCTCCCAGTAACCACGTGCCTCTCCTCTTTGTAGA
TCCAGGGTTGAAGAAACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAGATCTTGGCAACTGACACTTCATGTAGATCACATGTATTATCGA
CTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCCCAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGG
CGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAATCATTGGCGGATCTGGTTGTAGAATTCTTCCA
TCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAG
ATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGTGAACACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCA
CGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTCCTGTATTCGCCGTTCGATCGTTGGGCGCAGTGAGACAGACCCGACGGTAATCTTCAGGGT
CGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTGGGCGTCGGAGCCTTTTGGCG
ATACTAGCCGGATCCGACCGCCGCCTTCCTCTGGCGGTATTTCGCGCGATCCACAGCCCGCAGCACTTCCTCAAGCTCGTCTGCGTCGGGAAGTCGCAAC
AGGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGCCTCGATGAAATGATCCACATGTTCCCGCAGCTCCTTGGATCCCCCATCCTTGATCTTCAACT
TGGCCCGCTGACCGGCCACATTTAGTCGATGTAGGTACTCTAGCGGGGATTCATCCGATCTGCGGCGAGCATCGTAGTATTGTCGTGCCACCGACACTCC
CAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGCTCCTGGCTGGCCCCGCT
AGCAGATCCGCAAAGGACAAACACTTCTCATCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCAT
CTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGGGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTAC
CACTGCTGACGAAATGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACTGACTCCATCTCCACGTCTCGTGCTCCA
TGTTCGTGGAGCACTTGCACTTGTGGCCCGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCG
AGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGGGACTGGATCCGTGAGGCGATTACCTTGAGCTCGATCTGACGATAATCCCACTGGCTT
CTTGTCGGATCTGGCTCGATCGTGGCTGGATTGTGTCAAATCACGCGTAGGGCGTACTGGATCCCGAGCTTTCACGTTCACCGGGGCTTCCTGTCCTCGG
ATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCAGACGACGTGTCAGACTCATCCTCAGCGGCGGATTCGT
AGTTTGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCG
CGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCTTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCT
TTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTT
GATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGG
AGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTTGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGCGTTGGCTTAACCGGT
GAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGG
GAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCTTAAAACTCCATCGATCCGCGGATCTTGTTTC
ATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAG
TCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGA
CTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAA
GAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATC
CTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTGTTGTCCTTTA
AGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGA