Description :
From Genome Similarity Track
Location :
Scaffold_352:39482- 40862
Sequence
1380 bases(100 bases per row)
GCCAAGCGAGTGTAGCACACTTTCAGCAATTATAACAGCGCGACTACTTCTTTCTCAGCGGGATGATAGCCGAGTTCATTCTCCTTTAGTACGCGTCCGC
AGAAGCGAACTTGGTGCAGTTAGTCGTCGTGCGGCTGCATCATGGTACTGCTCAGTGCCCAGTCATTGGCGTACAACATTATGTGGACTTCTTTCGCCGA
GTCGAAATGGCGCAGAATTGGAGCTTCAGCTGCCCGTCTTTTGAGCTCGGCGAAGGACGCTTTTGCCGACGCCAAGTCACCCCCAGGACCAAAGTCCGTG
TCCTTTAGCTGATAGAGTACCGCTCCATAAACAGCCAAGTTCTGGATGAATCGGCCGTAATAGTTAAGTGCACCGAGGAAAGCTTGCATCCCTTTCTTTG
ATTTCGGGAAGGCGAGCTCGGAGATCGCGGCTATTTTCTTCGCATCAGCGCGTATGCCACTCGGCGTAATCTCGTGCGACAGGAAATCAACCTTGGGTTG
GACAAATATACTCTTGGTAAAGCTGATGCTAATTCGACATTCTGTGAGCCGGGCTAGTAGTCGGTCGAATGTCTCCAAGCAGGCGTCAAACGTCTCCCCT
CCAAATCAGATATCATCGACAAACGACCTCCGCTTGAACACCGGAATCAAAGAAGACTGATCTGGTTCTCCATTAGCAAACATGTCGCCGTCCGGTCCAT
TGACCAGGTCTCGGACCGGATCGCAGTCAGCTTGTGATTGGTGGTCCGCTTCGAACTTCGTCAGCTGACCTGGCGTGGAATCGCCGACTCCGCCGAGCTC
GACTCGCCGAGTTCCCGACTCGGCTTCAGCAATCGACATTCGTTCAGCAAACAACTTCCATCCTCCCTTGGGCTGAACGTATCCCCATAGAGCGTTGTCG
ATGAGACGTTGATAAATCATAGGCGCATTCTTCAGTCCAAACAGCATTCGTAACCATTCCAAGTGTCCAAGTGCACAGACGAACGCTGAGATCTGCCGAG
CTCGACGAGTCATCAAGACTGCCCAGAATCCGCTCGCAGCATCAAGCGAACAAAACCACAGGTAACACTCCAATTCGGTGAGCAGGTCATCGACTAGTGG
CATAGCGTATTCCATCGGGCGTCGTAATCGCATTAACTAGTTTATAGTCAATGCATAGCCGATTATCCACACCATTTTTCTTCAGCACTATCACCACTGG
TGAAGCCCAAGGGCTGCCCGAGAATGCTATCAACCCAGCTCGAAGCAACCCCTTCAACAACTCGTACAGCTTGCTCAAGTGGCGGAGAGGTATCCGCCGA
GCTCTCTGCTTGATAGGTGCGTGTCCTTGAACGTCGATGTCGCACAATGCTCCGTACGCTGGAGGCGGCAGGGCATTACC