Description :
From Genome Similarity Track
Location :
Scaffold_94:3948- 6879
Transcript NameFunction/comments
Phyta_totarag3426hypothetical protein PHYSODRAFT_516025
Phyta_totarag3427conserved hypothetical protein

Sequence
2931 bases(100 bases per row)
GCGCGCGTGCTCAATCAGTCGTTCACACAGGCGCAATATCTTCAGTTCTGGGTGCGTATCCCGCTGACGGCGAGACAGAAGTCGAATGCCAAGGCGCCGA
TGGAGGTTGACCCTGTGGCGGGGCTTCGTGCTGCCGCCATGATGGAAAcagacgaggaggagagcgagggGTTGACGGATCCGTGGGAAACCTGGGACGC
GTTACGTGCTCGCTGCGAGCACCACCCGAAGCTGCACGTGGCGCTGGAAATTACTGCTGACCTGCCTAGCACTGAGGAGATCCAGCGCTGGCTTGGTGAG
CCTGTTAAGGTGGGTGATTAACGCTAAACGCGTTGCTAGTGGGCTTGTAGAGACATAGTTCATCTAAACTTTGTGTTGTGAGCGTAGGCAGCGATCATTC
CGACGGATATCTTCCTGACTAACCGCAAGGGCTACCCTGCGCTGTCCCAGCGACACCAAAAGCTGATGGCGCAGCTTTTCCAGCACAACATTCAGTTCTA
TCTGAGCGGGCGACCTCGCCATCGTGGAAAGATCCTGCCGTATGTACAGTATCTGCACTTCCTGTACAGCAAGCGCCCGAGCCAGGACCGCAAGGCGCAG
TTCGAGGCGCCATACCTAGACTATCTCCAGGCCCCGCTGCAGCCTCTCATGGACAACCTGGAGTCGCAGACATACGAGACGTTTGAGCAGGATGCTTTCA
AGTACAACCAGTATGAGAAAGCTATCACCCAGGCGTTAGAGCAAACCCCCGAAGACAAGGAGTCCATTGTGATGGTTGTTGGCGCCGGTCGTGGGCCCCT
CGTACGTTGTGCTCTTCGCGCCGCTACAGCCGCAAACCGCAAGACACGTATGTTCGCCGTGGAGAAAAATTCAAACGCAGTCATCACTCTGCGCAACCTC
AAGATTTCGGAGAAATGGGATAACGTCACGATCGTGGCATCTGACATGCGTAGCTGGCGCACGAAGGAGCGCGCCGACATCGTGGTGAGCGAGCTTCTGG
GATCATTTGGAGACAACGAACTGTCCCCTGAGTGTCTGGACGGCGCTCAAGACTTCTTGCACGGTGGGTGCTCTTGTGTTTCGTATCTGCTACAAGATAC
TAATTGTTATGTTGGCATGTTGTAGAGAATGGAATTAGTATTCCGCGTGAGTACACGTCATATGTGGCGCCTGTGATGTCTTCAAAGCTTTGGAACGAGG
TGAAGGTCCATGACTCGCTCAAGAGCTTCGAGACGCCCTATGTCGTGCGCCTACACAACTTCTACGCGTTGGCGCCCACGCAGAGCTGCTTCCGGTTCGA
GCATCCGAAATTTAACTCACGGGTCGACAATAGGAGGCAAGCAGAGCTTCGCTTTACCGCTGCTGAGAGCGCTGTCGTCCACGGCCTGGCCGGCTATTTC
GACGCCGTGCTGTTCGGTGATGTGACGCTAAGCATTGAGCCGGATACGCATTCCGATGGCATGTTCAGTTGGTTCCCGATTTACTTTCCCTTGCGCCAGC
CGCTGCGCTTCCAGAAGGGCGAGGAGGTCGTGGTGAACTTCTGGAGACTCGAGTCCAACAACCGTGTCTGGTATGAGTGGTCTGCATCTTCGGGCGACGG
TAAGTGCCACGTGCCCATCCATAATCCCAACGGGCGATCGTACTGGATTGGACTGTAGGAATGGgtgatgaagctgagaaGAGTGTCAACGCAATTCAGA
TCACCGTCCAGTTCATTATTCAGTCTGAGGCTAGTTAGCTACCTGAATGAGCTATCCTAACGCTGAATAACATTGTGTGAATGGAGTCGTATCTGCACAC
GATGGAGTTGGATCACTAGAGCTCGTCGCTGGCTTGCGACTTCTTCACAGTCTGGACGATCTTTTCTCGGGTACTGCCCTCCGGTTCAacgcgcgcttct
tccgcagcttcgtctggGTGGGCGATTTTCTCCCAGTCTTGTAAACTCCCGCCAACGACATTGAGAAACACGTTTTTGAGTACCACCTCCATCTCGTAGT
CTCCACCAAGTCCACGTATCTGCGTGAGTAGCGTCGCCAGCGTCTTACTGCAGCGTTTCAGCCGCTTTGGCCAGGTAGAACGCTGCGAGTGCTTTGCCAA
CAGCTCCCAGGCATCAGCAATGCCGTTGCTTACTGCAAAGCGCAGacttgcagcttcaccttgtgCGTCCTTGAGACTCACCAGATTGACAcccgtggtg
ctggagactAAAAGTACCGGAATCGTGATGTTGTACGCGTGCCAGCTCACCTCGACGACCGGGTGAGTCATTAAAGTTGCGTTGTCATGCCGtgtgagca
gcaccacactTGCACCACGACGTTGTGCATTGGACACCTTTTTGAACTCGGAGCACTGCCCTGCTTCACCCGCCGGGATCAGCACAGCTTTCCCGGACAA
CTGCGCCTGCGTCGTACTATCCTTCTTAACATCCGCGCAAGCTTGGCTTCCATCAAGTGGCATTGCTAGAGGGAAAGACATCATCGTGGGCAACACGCTA
CCATAGGTCGCTGCCAGGAAGTTGCCCAAGCGAGTaccatcatcgtcttcctgcTTGTCAGACAAGACTGAGCCACTGCGAGCGGGTGATGCTTCAATGT
AATCTTCCTCGATCTCCAGCCGTGGCTTGCACGTGTAAGGTTTGCGCTCGCAGGTCATAGGGATGAGGCGTCCGTAGATAGTCATCTGCTTGGCCACAGC
ACGCAGCATGTCGCCGGCTGTGCGCCGGATCATGACGGACGCAATGGAGATCTCGCCATCCTCATCTCTCAGCACCGCCACAGGAGCACTGACGTCGTCC
GTGGGGCTTACTACAACAAGAGCAGCGGCGCCCATCTGGTCAGCTAGACGTGCCTTGCGTTCGAAAGTACACTCTCCGCGGTCCACAACGAGCACCGCCG
ATCGGTTAGCGGCCGCGACTTCAAGCTGTTC