Description :
From Genome Similarity Track
Location :
Scaffold_27:3947- 5348
Transcript NameFunction/comments
Sapdi_VS20SDRG_08681hypothetical protein

Sequence
1401 bases(100 bases per row)
AATGACAATGATGCTAATCGAGAAGCAGTAAAACAAGTTGACGCCAAAGAAGAGTGCGAGCGCGATAAAGAACACGGCCGTGCCCACGACAAGCTGATTG
GCGCGGCGCTGCGCGAGGGGGGCGAGGTAGTAGTCGTTCCGGACCCACTGCAGTAGAAAATAGACGACAACGCTGAACGTTGTCATGAGGAATGCAAAGG
CGCCGCCGATCGGGATCGATGCCCAGATGAACATGATAAAAAGGAAGAGGACGGACCAACCCGCGCACGTGATGAGAGCTGATCGCACAAACGGCGAGAG
CACCCAATTATCATCGTGCCACTTGAAGACAGCGACGATGAAGAGCAGTGTGAGCGGGTAGAAAATAAGGACCACGAGGATCCAGAGCGACTGCACGTCG
TTGACGTCGAGCTCGAGCACATCCACAAAGAGCGCGATACCCAAGACCCACGCGAGTCCGTACGAGAAACGGGCACTAGCGCGAATGTCCGACGTGATCT
CAACAACATGGTACCACTTGAAGACGGGCGATACGGAGAAGATGACAATATACGACCCGACCCAGATGGCCTCGCCAATCCACGGCGGTGCTTCCGTGAA
CGTGGCGCAGAATCCGTAGAGGAAGATACCGCCGAGTAGGCCAGCAAAGCAGTGCAGCGTCTGGTACTCGTCTTCCAACAAGTAGCCGCCCCGGTAGGCG
TCGATGACGCTCATTTTTTCAAAGTCGACCTCGGCCGTGGGCACAACCGAGTACTTTTTCCATGGGTGAGCCAAAAAGCTGCGGGCGTTGGCTATGGAGG
TCCGAAGCCGCGCACAGCACGACTGGCGCGGCGGCGCCACGACCGTAGTCGTGCTCGGCGCTGGCGGCGCGTCGAGGATCTCGATATCACGCATCGTTGG
GTTTCCATCTTCATCGACAGCAGCAGGGACTGGCGGGGTATCAGCGATATCGGCTTCCTTGGCCGCAGCCTCCAGCTCGTCATCATCGTCGACGCCAGAT
GTCTTTTGGTTGTTCTTGTCATCGTCATCTGGTTTGCTGCTCTCAGCGGTCTGGCCCGCGAGTTGCAAGACTGACGAAGCGGCACCGCCGAGTCCCAGAA
GCGCACTGCCTTTGAGTACGGGCAATGGTGGCATTTTGAACTCGGTGCCGGGCGCCGACGCTTGGAGCGACGGCAGCACAAACGCCGACCGGAGTGCGTC
CGCCTCCTTTGCAAACTCGGCTTCCTCATCGAACGCATCGTCGTCCATGTCGTCGTCGTCGCCGTCTTCGGGTGGCCACACGACGAGTCGGTGGTCGTTT
CGGCGCCACTGCGCCCACACCACCGTGCCAAGCATGAGAAGAACGGGTAAAAACACCGATGTCAAAAGGACAAACGTCGATTGCGTCGCTGCAAAGAGGA
A