Description :
From Genome Similarity Track
Location :
Scaffold_14:394643- 398759
Transcript NameFunction/comments
Phyci_90952conserved hypothetical protein
Phyci_215079Hypothetical protein
Phyci_63321Voltage-gated Ion Channel (VIC) Superfamily

Sequence
4116 bases(100 bases per row)
AGGTGGAGAACCCGGCGTGCGGCATGGCGCGGACGTTCGCCATGATGCACGCGGCTGCCACTGCAGGACGCGCGCGGCTAGTGGTGGGTGTGCCGTGCAA
TACGTTCCACGCACAGCCCATTTGGGACGAGTTCATTCGGCGTACAGGTCGAGCGAGCGATGTACATCACGTTCACATGCTGGAAGAGACGGTTGCCTTC
ATTGCGAGGAAGCTGCCGTTGTGCAAGAGGGTTGGGCTGATGTCTACCACCGGAACGCGCAACTCGCGCGTGTACCATGATCTGCTCCAGCCGCGCGGGT
ACACTGTCGTGGAGGTTAATGCGGGGACTACGCAGCAGGAGCTGCACGAATCAATTTATAACCGCGATTGGGGAGTCAAGAGCACAGCTCCAGCTGTGTT
ACCGAGGTGCGAGGCGAACTTCCATCGCTATGCTATACAGCTACGAGAACAGGGGGCCGAAGTCATTGTTCTTGGCTGCACCGAAATCCCGTTTGTATTT
GCTGGCAAGACGCACTTCGCCGGTATTCTCCTCATTGACCCGATGGTGGCACTAGCGCGCGCTATGATTCGCGAAGCAGACCCGTCGCGATTGAAGCCCA
TGGGTAGCAGCACAACGGCCAAGGCATCAAGTACAAGTATCTATTCTGGCGTGCCGCTGAGTGCGCCTGTGGCTAGTCCTGTTCCGCTAGCGCCACTGAA
ACACGTTATTGACACGACAACACCACCACCACCATCTTCACAGACTCCTCGTGCCAATTGTTCGTGATTTTCTGTAGACTAGTAGACGTAGAATCAGGCA
CGTAGCCAGTCTCTGCTAAGGTTCAGCAGCTTCTATTCGCACTACATCAACGATGATAACTGGTTTAAGAAGTATGTCGCCTTTTCGGAGGCAGCCGAGT
CACCTGCAGCACCCGCCTGTGTTGTGTCCTCGTTCGTAGCCACCGCATCCTCCCGCTGTTTACGGAGACGTTCCAAGCGGAGCTGCTTCCTTGTCTTCCT
GTCCGCCGCTCCCGACGAAGAAGAGTGCGCCAACGCCTGCGCAAGCGTCGCTCGCTCATGCACCTCCTTCAAGTGCTTCTTCTCGGTTGTTTTCAGTCGC
TTCTCCCACTGCGAGACCACAAAGCTGCCGCCACCAGCCTTGCCTTCCGTATCCTTATCTTCACCAGGGTAATTGCAATGATCGTTGTCCACCTCATCAC
GAGGCGGGTTACTCCCATATTGCTGCTGCTTCTCCAAATACGCCGCGTACTCATCACTATCCGTAGCGACACTTCTCGTCCGCCCGAACTCGTCCGTGAT
CTCCACCATCGTCTTCTCCTTGGTATCCACGGCATCACTCATATACTTCTTGGCGTCAAAGTCTACCAGGCACTCCCCTTTCACACTGTCGGGGCCTCCT
CCGTTGGCCATCTCCTCGTACAATTTTGCCTTTTTCCGTAGCATCTCCGCCGATTTTTTTCGCCAGGCTTCGTCGTCGTCTTCATCTGGCGCTTCTCGCT
GCCTCGCCTCCTCATCACGCCGACTGCGGGCCTCGACTCCACTGTTGCGGTTCTTCTTGCCCACTCTGTCTTCGTCCGACCGCTTGCGGCGCTTGCTGCC
ACCGCGCAGATGTGCATACTTGCCCAGACGAAGAGCTCCGTGGCCAGTTGCCGGTTCGTCGTCGTTCTCGGCCGTTAGAGCTTCCTGCAGACGGCGCTTC
CGCTCCTGGTCCTTCTGAAAGACAACTGCCTTGAGGTCCACGAGGGACTTGGCGTCCACCTTGATCTCCTTCGCCTTGGACGGCACGAGCGCCGACTCCG
TCAGGAACCCGAGCGACATGCTGACACTTTCTTACTGTTTTTTGTTATTTTATTGTGAATGTATTTTGTGATTAGTGCATCGAAATTTGTATATGGTGTA
CGGGTTGTGGCAATTTTTGAGCACTTCAACTTGGGCAAGTGGTTACGTACGTTGTCTCGTGGCAGCCAGATCTAAATGTGTACGCTGCACCTTGACCATC
GCTATCTAGCTTCATCTGCCGACGGGTATAGTGCCGCGAGGGTGTTATGTTCCGGCGCAAGCCGGTCAAGGCCCTAGTTGTGGCGGGGGCTGTTGACGGT
GATACCGAGGCCACGATCCTCGAAGCGGGTGGCGAGTCAGGAGAACCAAGCTCGACACAACTCGAGCAACAGGAACCCGTTGCAGCTTCGAGTACTCCGT
TGAGCAAAAAGCTGCTAGGTGGATTAAGCAGGCACGAGAGCAAAGCACAAGGTTCGACGGATGCCCCCAACACCCCACGACGGAGCAATGCGTGGTCTCG
CTCCACAGGCAGCTTTCTCAAGCTGGCATCGGACAACGCCACCATCAATGTACTGCGAATGTCATTGTTCGAAATCCACGAGAGGATGAGCTATCGCTGG
GTTTTGCATCCCCAGTCGCCTCTCAAAACGTCGTGGGACCTTATGAGCGCATTCATCGTTGTTTACTACTCGTGGATTATCCCCTTCATGCTGTGCTTCG
ACTGGTACGAACCATCACACGCTACTACTGTTTTCATGAAAGTGCTGGATGTGTGGGGCTTCCTGGATATTGCGCTGAGATTTCGAACTGGTATTATCGA
GTACGGGGCCGTGGTAATGAACCCGCGCAAAATTCGTCGAGCATATATCCGCTCTGTTTGGTTTCCCATCGACATAGCCTCTTCGTTCCCCTTTGAATAT
TTCATCAAAGAAACCTCGACCAGCGTATCAACTAGGAAGACCATCAAGATGATCAAGTACATTAAACTGCCACGCCTACTGCGACTTGGTCGTTTTGTCA
AGTACCTGAAGCGGTACAAACGCTATTCGAGCGTGACTATTGCGCTCAATGCGGTGATCTTCTCTGCTCATGTGGCCGGATGTTTATGGGTTGCAATTTT
GAAACCGTGCGCGGACGCTGTCGAAGCCACCCGACCGCATTGTCAAGATGGCAGAGAAATGGATGTCTACTGGGTCGCTTTTCACCATGGCATGGTGTCT
TTATTGGGTGTGTCAGCAACGCATGTCGAAGCCAGCGATCGCTTTCTTAGCGGGGGTTACAACCATGCCCCTAGCGATGACCTAAACAGCTCAGTCTACC
TTTGGTCCGTGGCATTGTCAGTCTATGGCGCCGTCTTGACTGCTATCCTATTCGGCACTATCATTGGCCTTGTACAAAGGTACCCGGGATGAATATCATT
ATCTAGTGCTAGCAGTGGAACAACACTAACACAAATTGTTTATTTTACGATGTAGCTGGAATAGGGCTGAAAATGCCTTTCGGAAGAAGATGGATCATGT
CATCCACGAGATGGATGCGCTAAGTTTGCCGAAGCCTTTGCGAGTGCGTTACTACAACCTTTTGGTTTGGAACTTCCTTGAATCCATACTGACGGTATTT
TGTTTGTTAGGCACGAGTGACGGCGTACTACGACTATCTCTGGCTAAATGTACGCTGTGTACAAACTGCCTTCGCGTTCATCTTCATCTAGCTAACGGAT
CTTGTCGTCGTGCACGGCATAACAGAATCGCGCACTGTCCGAGCAGCTCAATCTACTGCACGATCCGGGCATGTCGTTGACTCTGAGGAGACAAGTTGCG
ATCTACCTGTTCAAGGACAACCTGCAAAAGATCCCGTTTTTCCAACTAGCCACAGACGCCGTACTGGGTATGATCTGCATGCAGCTACACCAAGTCATCT
ACATGCCGGACGACTTTATTATTCAGGAGGGCGAAATCGGCAAGGAGCTGTTCATGATCGTGAAAGGCATCGTTCGTGTGCTGCCTCCCAAAAGCTGCAA
GAAACCACAGGCCGAAACGATCATCCTGCTATCTGAGGGTGACTTCTTTGGAGAAATAGGCGTGGTAATGGAGGTCGAACGCACACGCAGCGTGAAAGCT
GAATGCATGGCAGAGCTCTGCGTTCTAGCTCGAGAGGGATTTGACAAAATCTTGGTAGAATTCCCGGAGTTCGCTACTGCTATGAAGAAGCTGATTGTGC
AACGTGTGGGCGAGATGTGGAAAGATGACGGCCCCGAACGCATGGAGAAGATGACAGCACTCGCCGACGCCAAGATGAAAAAGACTATCGTGGCCTATAA
GAACATGGAGAAACTG