Description :
From Genome Similarity Track
Location :
contig_38:394630- 431920
Transcript NameFunction/comments
g8397.t1hypothetical protein
g8398.t1hypothetical protein
g8399.t1hypothetical protein
g8400.t1XP_009515436.1 hypothetical protein PHYSODRAFT_469968 [Phytophthora sojae
g8401.t1hypothetical protein
g8402.t1RAW41877.1 putative ATP-dependent DNA helicase [Phytophthora cactorum
g8403.t1hypothetical protein
g8404.t1XP_008911572.1 hypothetical protein PPTG_16044 [Phytophthora parasitica INRA-310
g8405.t1hypothetical protein
g8406.t1hypothetical protein
g8407.t1hypothetical protein
g8408.t1RAW41903.1 hypothetical protein PC110_g1893 [Phytophthora cactorum

Sequence
37290 bases(100 bases per row)
CTTGCCGACCGCTACACGCAGAACCGGTTGCGTCTTCTTCCGCTGCTGCTGCATCTTAACGACCGTGACCTGGTGCTGCTGCTTTTTCGGCTGCGGCGCC
GTCTCCTCCGCCAGGTGCGTGAAGCGACTGGACAGCGGGACGGCTGACACGCCGATCACGCCGCGAGGGCCCTTCTTGCCCGGCTGCGGCTGCTGCTGGT
TGTTGTTGATCTTGCGCTGGCCGCGGACGGACGCCGCGGGGCTCCGGATCGCCGATGCATTCTTGGAGTCTGAGCAGCTCTTTTGCTTTGTGAGCTTTCC
ATCGGATTCTTTCAGTTGCGTGAAGCCTTTATGTTGCGCTTAAAGTTTCACGCACCTTTAGCACCGCGCGCAACTTCGGCGAGAAGTTTAAAAAACCGAC
ACCAAGGCTGGCCATGGAGACGCTGGCGCCCAGGTGCAGCGCTATCTGGATGCGTACGTGTACGAGAACGCGCGGTTCCTAGCAGAGACTCGTGGCGCAG
GTAAACAACCGCTTGGATCGGATTTGAACGCACTGAAAGCTGCGATACTGCTGTTTTAAACGCAATAAGTATCTACGTCATTTTAACACTTTTTGACCAT
TTATCGCTGTTACACGCAGCGTCCGAGCGAGGAGAACGTCTGCTGTTAGCCACGTGCTACTACCGCAATGGACAGCAGCTCGGGCGTCGGCGGTGCTGAG
TGGCGCCACACGACCGGATAATCGCTACTTGCTGGCTTGCTGCTGCTTCCAGCAGGGACAACTGGTCGAGGCGGAGAACGCGCTGCTAGGAGGTGAAAAC
TGCCACGTCGATGACGCAGAGACAGTTGAGAACATACCTGCGGGAGCTGCTGGGTTGTTTCTACTTGGAAAAGTGTGCAGGCGTGGAAACAGGAGACAGC
AGGCTGTTGCCTGCTTCGTGAAGAGGTGAGACGATGTTTCGGTTGATTGATTTTGTGGCGAGTTTATTGATCTTTGTGTTTGTGTTTGCGTTGTGTTGTG
TTGGCGACGGAGTTAGTTTGGAGGTGGATCCGTTCATGTGGTCGGCGTACGAGCAGCTTTGCGAGCTTGGAGCCAATCTCGAGGCCTCGAGATTTTTCGG
CGCAGCAAGCACCGGATCGGCAAATGAAGTGGATTCCGAATTTTCACTTTGCCCGGAGTTTAGCGATGCAAGTGTTAAAGGTGGACATCAATTTGGTGAT
GAGGAAGGACACTACCGCGAGGACAACAACCCAGAGGATCGATCCACGGACGGAACATTGGGAACACCGGAGACTCCACTTTGTTTTCGCCCTTATACGC
CTAAGAGCATTTTGACCTCATCGTTGAGCGCTTCTCGACCTATGGGTTATAAAACACCAATTGTCAACAGCAATAACGGGAAAGGTATGCATACAGCGAC
AGCCGTGAAGAAGCCGCGAATTGCAGATGATATTGGTGCTCCTGTACGACACAGGAAGGTTCATCGCGACCTCTCGCAGACAGTGACGAAAAGAACCGAA
CCATTGCAAGGCTGTCATTCTCTGCTGCTGGCTTCGACGATTCTCCACTGGTACGGAACCAATCAATATTGTACTTGAATGTAAACGTAGTGGGCTGACT
CATTATATTTTATCTGCGCAGAATCCGTCGAAATTAGCATTAGGCTCTCCCATCTCCACTCGTTACCAACAAGACTCCTGGCCCTTTCCATAGAGAAGGA
TCATCACGTAATGGCCGGGAAGAGTTGCTCCGCCTGCTGAGTTCGTTTGGCTCTATTTATCAAATGTTGAGTGTGTACAAGTGTCTAGAAGCACTGGAAA
TGCTGGAACGGCTTCCTGACGCTCAGCGTGCATCCGGTTGGGCACAGCAACAGACTGGTCGAGCACATTTCGAAATGGCGGACTACGTGCGAGCGCACGA
GGTGTTCTGTGCTTTGCACAGAGCGGAACCGCATCGGATGGAAGGTCTCGACATGCACTCAACGACATTATGGCATCTTAAGGAGGAGGTGGAACTGTCG
TATTTGGCTCAGCAAGCAACAGACTTTGACAAGTTATCGAGCGAGGCCTGGTGTGTTGCTGGCAATTGTTTTAGCCTTCAAAAAGAGCACGACACAGCGT
TGGCCTTCTTTCAGCGGGTAAGTTGGTTCGGTTGTATCACGAGAGTTCAAATTGGCATTGCTGACGTATCCTACGGTATGTCTGCTATTAGGCTATTCAA
CTGGACCCGTCGTTCACATACGCGTACACGCTCTCTGGTCACGAGTACGTCGCAAATGAAGATTTCGAGAAGGCAGTGAATTGCTACCGGCATGCAATTC
GTACCGATTCACGGCACTATAATGCGTGGTACGGCCTGGGCGCGATCTACTACCGGCAAGAAAAGTTCGAGTTCGCCGAGTACCATTTCAAGCGTGCGCT
CGAGATCAATCCTCGGAGCTCGCTGCTGCACTGCTTCCTAGGTATGGTTCTACACGCCACCCAACGGTGTGACGAAGCCCTGACCACCCTCGCCACCGCC
GCCGAGCTCCAGCCATTAAACCCCCAAGCTCGGTTCCAGCGTGCCAATGTCTTGATCACCCAACAGCGATACAAAGATGCTCTCGCAGAACTCCATGTCG
TCAAGAACTTTGCGCCGCGCGAATCCTCGGTGCACTTCATGATGGGCAAAGTGGCCAAGAAGCTCGGCCGAACCGAGGAGGCGATGAAGTACTTCACCTT
GGCGCTGCACTTCCACCCGAAGGACAATAACCAGATCAAAATCGCCATCGACAAAATCAACGAACCGGACCATGACGACGACGACCGCATGTAGCGAGTC
ATCGATGCATCTGCAGCGCCAAAGCAGTAGCCTACGATATACTTTGAGGTAGATAACAGCAGCATCAATGAAGCTTTTTCACCGGCCACATAGACATGGC
CGTTTTGCTTTTATGTGGCATTTGAGATGGTGCCGCCAACAGTGAAAGTCGAGGCGCTGCTGCTGCTGCAGCAACTCACGCTGTTCAAGGAGGCGAGCGA
GGCACTCACCCGTCTGTTCGAAGGGTTCTCTGAGCAGGATTCCGGGCGCTGCGCCGTGCTGTGGCAGCTTCTGCAATGGCAAAGCACAACCGCGTCCAGC
AGCCTCGAGGATGTGCTGGTCGACTTAAAATCTAGCGGTGACAGCAGCCAGACGGAGGTGCGTAGCGATATGGAGCTCACGGTGCTGGGCAAACCTGCTC
TGCTGTTTGCCGCCTCCATCTACGACGAGGAACTCGCCATGTTGATCTGGTCGGGGTTCGTCCAGTTCCACGCGCGCTACCCGCAGTTTGATCTGCCGCG
GCAGGTGCTGGACAACTCGGACGACTCTTTGGGCTATTCGGCGCTGCATTATGCCGTGGAAGCGCAGATGACGGACTTCCTGCGTGCTGTGTGCAAGGAG
TGACCCAAGCGCAGACAGCTCCTCTTGTCGGCCGAGTTGTGACGCAAGACGTGACTTTGCCAGTTAACACCGCGCACACCATGGGCAAGAACATTGCCAG
TGGAGGCTGCTCGCTGCTTCATCTTGCGGCCAAGAAGGGCGAGTTGGAGATGGTGCAAATGCTGATTGCACCCCCGATGCTCATGGACCCCAAGACACTG
CGCGACTGGGACGGCAACTCTCCTGCTCGAGTGGCAGCCATCCACGGACGTGACGAGGTCGCTGCCTTTCTAGAGGTACGGAAGTGCCAGAGCAGTTTGC
GAAGTAGGTATTCTAATGGTTATTGTGGTGACTGCTTAGGGTATCACTGGGGAAGCACCATTGAGTGTTTCGGAAGTCGATGACCTGCGAGCCAAGCGCG
AGAAGATGGCCAGAGAGCGTTACCTGGCACACCTGAAGCCCCAGGAGTCCATGCTAGAGCCTTCAGTGTTTGCCAATATTTGGACTCTCGAGGAATCGAC
GCTGATCAGCGATGAAGTCAACCTCTTGGCCGCTGAGCAGGGTTGGTGCAAGGAACGGCACGCGTCTTATCAAACGACGGACATGCCGTGCCACCACGTT
GCTGGATTGAACTCCTGGGTGCGCGCGACCTTGGCGGACAGGCTCTTCCCTCAAATTGCGAAGCGGTACAAGCTCCCCAAGAACCAGCGACTGCTTTTCC
GTGACCTCTTTTTCGTCAAATACGAGGCACGCAATGGTGAACGTTCTGAGCTTGCACTCCATCGCGACGGATCCGTGTTGTCTTTTAATGTGCTACTGAA
CTCGGCCGACGACTTCACGGGCGGTGGCACCTACTTCGACGCCACAAAACGCACGGTGCACATTACACAAGGCGATGCAGCAGTTCATAGCGGAAAGGTT
CTTCACGCCGGTGCCCCTGTGCTGTCAGGCATACGCCAAATTCTTGTGGGCTTCCTGGACGTCGCCGACTGTGTGTACTGAGTGCCTTCACACTCACAAA
CGGCGAAATTGAATGCCTTCTATAGGCGTGTCTCCTTCAAGCACGTAGAGTCTCGGACACCAATGCTTGTCATCGTACAGGTCGTCTTCTAGAGAAGTTT
GGATGGAACTAGTGGCTTTAGCCTTCCCGAACGCAACACCACACACAACATTAGCAACACGATCCAAATAATAGAGCATACTTCAAAGTAGACAACTGAG
ACCATAACGTACCCGTTCGAGTTCAAAGAAGAGCAAGCGGTCTTCCCAAATTTTGTCGTAGTGTTCCCCAGCATCTACAACAATAAAAACAACAGCCGCA
GCAGCTGATTAGACATGCTCGTGATGTTCATTGCTGTAAATACTGTACGTACGGCAATCAAGAGATTTAGGAGCATGATAGTGCCGATGACCACGAATGA
AATGAAAAAGATCATTGCAAGCAGACCGCCTTCTGCGATGCTATCCCAATCCCATGAACCCAGACTAATGTTGAATGTCGTAGTCAGCGCAGTAAAATAG
CTCTTGCATCCCTCCAGCTTCAAGCACAACAAAACCAGAGATATGCTAAATATTTTTCGTGCTCGTCCCAATATAACGCGCATCGACTACATCGTACCTG
AAGTATGAAAAACGCAAAGGCAAAGCCGCCCAGGAACACGCAGAATACCATGAGGAAAACCAGGATGTCGGAGAACATCTGCAGAAAGGTGAGTGCACAG
TTAGCCCGGAGTTAGATACATTCCGTTGGACAGCGAACCCAACCTTCGCAATCATGCGAACAAATGGGCCGAGTGCTCTGGTGCCTCGTGCAAATTGAAT
CCACTTGACGAAGATTTGCGGTCCGACAATGCTCATAAGCGTGATACGGAAATTGTATCGCCTTCGAATGTTGGAGCTGTACAACGATTCTTGGTAGACG
ATGAGGCGGAAGTCGTCGTGATCGAAGTCTTGAATGAACACGAAGGTGTTCGTTAACCCTAGAGTTAAGCGAGAGGAAGAAGTCACATGTACCATCAATT
TACCTGGAAATATGAGCTCGAGGATCTCTGCGACGAGTAGGAGCCATACACAAGCAATTTGCACCAGGTCGAACCAATTCCATCCATCTCGTAGGTATAC
ACGAAGACTTCCGCATTCTCTGTATGCTTGATACTAATAAGGACACAAAACAGTTTAACCCGCGGAAACCAGTGCCTATGGGACTACAGCATATAACTGT
ACCTCTTGGAGCGTGTACTTCGCGTTGATGACAGAGTAGACGAGTCGTGCTACATCTCGAACGTATTCCATGCACCCAACCGTTTCGTTGAAAATGTTAT
TGCGATAGCCTCCAAGTGGCATTCCCACAAACGTGTCACCCACATGCAAGTACCTGGGGTCCAATCCAGGTGTCAGCTGTTGCTAGACTTCATTGCCCAT
ACACAATCAGAGAGTGGACGTACGTGGCAACGAAAACGGCAATAAAGTAAATGAAGTACACTTTGAACTCGGACCTAAATGTCTGTCGCGTGAAAGAGTT
CCATCTGCAGTGACAAACTTTAACCCCAAGCAATTTATGACGTCATTGCAATCATTACATGGCGATACGTACTTGTGGTCCAATAACTGTCGGAACCACG
GGTGGAAAATGAGATCCTTGCATTCTGTCTGTCCCCCGTTAAGTCACGTTGATAGATCGTCAAGTTGGCTGATTAACCCAATCCAAAGATTAAAGCACCC
TACCTGCACTATCAGCCACAATGTTGGGCTGTGTCGGCCCCGAAACTCTGCGTGGTCGTAGACATATTCATACAAAATTCCTTTGGGCTCGCACACAATT
CTTTCTTTATGCCCAGTTTCATTCTCCGTCACAGTAAACACGTGCTGGACGCTCAATACACTCCTGATGTGACGCAGAAATTTCCACACTTTCTTCAAGG
TTTTCCTCAACCTGTCGACTACGCGTTGCATTACACCCTGACTTCGCTTGCGTCGAGGAGAGCGACCAACTTTTCCCTGGCCCTTCATCTGGACGATCAA
TGCGTCTCGCTTCTCGTGCAATGTTTTGATCATTGCCAACTGTCCAGGATTGGTTGCGTTCTCGAACATGTCTTAGCATACTGCACCGGAACAATGGAAT
ACGGAACGAATCCATTGCCAACACGGCTGCTTCAGGGACGTTCTGGATCAACAGGTGGAACAGTTTGCTTCTCTCGTGTAGCTCCCGTGCTTTGTTCATT
TCATAAATGGTCACATGCTCAGACACAACGAGTATACCCAGCGTTTTTCGTGGTAAAATCGAATACCCGGGTGCTGACCGGAAGAACATGATGTCACGGC
GATTTTTCGTGCATAAGAATGGAGATGTTAGTAAGCTGTCGACGTTGGAGCATGTGCTGTCATTCGCGGTACCGACAGCGTCGTGACGCGCATTAGCCCT
TCCTGCCACAGTTTCAGGCGACACCGTGGCGGTATTTCCAGCTAAGATCTGGTGTTGCGGCGGATGAGTTTTGGCTGCAGGTGGACGTTTGTGCTGAACC
ATAGCTCCCGAGCGAATGTTCACTGATGGCAATAGCTTGGCCATCGCTTTTCCATCAGGAGATTCCACAAACGTCCCTCGCAGGGCAGTTCCATTCACCA
TGGTGAATGACACATATCGCGACATCCGAACATCGGCATGATTCTCCACGAGATGAAGACAAACTCCACGACGTTGACTAGCTATCGCAAAGTGAAGTCT
ATGCGTGAAAATAAGAGTAGTTAGTGCAAAGAAGTAAGCCGGGGCACAGCGATTTTTACGTTGATGTGACCACTAGGCATACTTACGGTGTCTCTCCGGC
TTTGTTTTGAGCATTAATGTTCGCCCCATTTGTCAATAGAAGCTTGCACAACGTGAGATGCCCACCTTCAGCAGCAAAATGGAGTGGCGTGTTGCCAGCT
GCATCTTTCGATAGAACCAAGGGGTGACCACAAATTTGCAAAAGATCCTGCAATGTGATGGCATCCTCGTGCAGCTTGTCGAGAGAGTCCGAGAAGCGAG
CGAAAGATACGCCAACATTTGCCACGAGAGCTCTCATCTCAACATCCGACTCACTCACCAGCCGCTTAGCTTTACGCATTTCGAGAATCATCTCCAGCAG
GTGAGTGAGTTGCATGAAGCTGTACTTTTGGTATGGAGAGTTCATTGGGTGCTCGTTCCAATGCATGATCAGCTCGCTAACGAGAGCCGTATATCCTCGT
TGAGTCGCTGCGTGCGTCACCGTGTACCTGCAAGACGAGAAGCTTCAGTATACTGCATCAAACCGTCAATGCAGCACGGAGGTACGTACTGAGCTAAACC
GTGTGGTTGCAGGAGGTCGAGTCCGTCATTCGCTTCGTTCCGCAGGATCCGAAGGATCTTTGGTAGATTAGGTTCTGCAAGTCGAAGGACGCCGCTTTCA
GTCCTCATTGGTCCAGGTACAAGTGGTCTGCATTGGCAGCACTCATCAAAGAGTAGCTTGCTTTGCAGCGCGAGGTGCTGTTCATCTCGCTTCTCCAGCA
GTAGGTGCATCCGATAGTATCTACGCATGGCTCGGTTGATTTTATCCGCCGCCCAGCCCTCGGGTCGCTCATCATGGTCATGTCGAAACTGACCTGCTAG
GAACTTCTTGATGTAGTTTCCGCCTTGCACCATGCGCGTCGGACTCTCCTTGATTTCGTTCTTCCCTGTGTGCGGGGTATTGTAACGAATGTGCTGCGCT
CGAATATGTTCTTGCCTGAGCTGCAGACGTGGAGGTCGTTTGCGCACGTCTTCCAAAATCACCTGCTTATGCTGCCTCTTCTTGTTCGCTCGAGCCTCCT
GCTCGTCCACGCAGCAAAGTCAGCAAACAGTACTAAAAGCCCTCCAATTCGATCAAAACGCCACCTTGATATGCGCTCGATACGCCTCCAGCATCTCGTC
ACGCGTCGCCGGAATCCCCGCAGACTGCATCGCCGTAGTGTAGCGCTTTGCAGACTCGGACGCCTTCTCCAGATTCTCAAAGATCGCCCAAAAATTAAGA
CGGTTTAGATATGGACTTTCGATTTCCATATTTAACAAACACACTATCGGAAGTGTCGTATTGATTTGCTTTTTGTATTACATGTACATTTATTGGCCGG
AATGGTGGAGGACGCCTTAGCTGCTGCATCCATGGACGGCGAGTTCTTCTCGTTCCCGTACACGCCGTACTCCATCCAGCTGGACCTGATGCATCAGCTG
TGGGAGACGCTGGAGCAGGGCCACTGCGGCATCTTCGAGAGTCCTACAGGCACGGGTAAGTCCATCAGCCTCATCTGCGGCGCGCTCACATGGCTCACGA
GGCACACGGACGAGTTCGGACTGCTGCAAGCGCTGGGGACTACAGATAAAGTCGATGCAATTGATACGGAAGCAGAAAAACGCAAGAAAATTGCCGAACC
GAGTTGGCTCGACGACTTCGAGCAGAGGAAGGCGGATCGGGAGGTCAAGTATCGCCAGCAGGTGGCTAAGAACGCGCTGGCTGGGATCAGGAAGCTCCGA
CTAGAGCCGGAGGCCACCACGAAGAAGCGCAAAATGCGGCATGCGTACAACCATCAAGAGCGGAAGCGGGTGCATCAGGGCAGCAGCAAAGTAACCAAGG
ACGGAGAAGACGAACACTTGGTGGACGCCTACGACAGCGATCGTGTAAGTCGCCAAACTAGTGACAATGAGGAAGAGAGCGGCGGGGGTTCGCTGGGGGT
GAGAGGTCGTTTTGGAGACGAGAAGCCGGATTTCGGCGTCGTGAAGATCATTTACTGTAGTCGAACGCACTCGCAGATCTCGCAGTTTGTCAGGGAAATA
CGAAAGACGGTGTTTGCGGAGCATATCCGAGTGGTGTCTTTGGGCTCTCGCAAGAATTTGTGCACAAACCCGGATGTTACGAAGCTGGGCTCGGATTTGA
GAATGGCGGACAAATGTCTGGATATGATGCAAGGCGGCAAGAGCAAGAAAGGCAAGAAAGTCGGCAAGTGCCCGTTCTATGAGAAAGAGCTGCTCGGTCA
CTACAAAGACTATGCCCTCGTGAGTCTCGTGTTTTATTTATTGTTTTTGGTGCCTGAGTGATTAACAAGTTACCGTTTGTGCAGGCTGAAGTGCAGGACA
TTGAGGACCTGCACACGCTGGGTGAAGAAATGTCTATTTGCTCGTACTACGGCACTCGTGAGAGCATCTCGCTTGCTCAAATTGTCACGGTGCCGTATTC
CATGTTACTGAGCAAAGATACCCGGGAGACACTGGGCATTGCACTGGAAGATAACATTGTCATCTTTGACGAGGCGCACAACATCATTGATGCAATCAAC
AACACGTACAAGGTCGAAATCACCAGTAAGCAACTGGTCGTCGTGCGACGAAGCCTATGGTCTTATTTCTCGAAGTATGAGAAGCGCTTCAAGGGTAAGA
ACGCGTTCTACATCAAGCAGCTGCTGTCGATCTTGGAGTGCTTGACGAAATTCCTTCGGCAACTGAGCAAGTCTGCTGGAAAATCCTCATCGACAGGTGA
CGAAGACGATGGTGCCCCAGGAGCACAGATGCTGACAATCAATGATTTCTTGTTCAGTGCTCGGATAGACCACTTCAATATGTTTAAGATTCTGGAATAT
CTAAGGGAAAGCGGTCTGGCAAAGAAGTTGATGGGGTTCGTCGAGTCAGCAAACGCTGGCGCTCCTGCAGAGGCACCGCCGCCACAATCTGTTTTAGACG
ATACAGACGAAGGCTTCCAGAGCCGGCATATCTCGCCACTCCGAACTGTCGAGGCTTTGCTAAAGGCCTTGACCAGCGTAGGCGGCGATGGCCGTATTCT
CGCACAACCGCATAATGTAAGCTCTGAAGCCCTGTTTCGACGTCGATAACGTGATTCCTAACTATTGTTTCTGTGCCCAGGCGAACAAAGGTGTTGAAGG
TTTGATAAGGTTCATTTTGCTCAATCCGGTCATACATTTCCAAGAAATCGTGAGAAAGGCACGGAGCGTCATCCTCGCCGGAGGAACAATGCAGCCGGTG
AGCAATAAGTATTCAAATTTGCAACCCTGTATATAACTAACATTTAGCTGCACGGTAGGTGTCTCAAATGATCGACCAACTATTATCTTCCGTCCCAAAA
GAAGACGTTGATTTGTTCTCCTGTGGACACGTGATTCCCCCCGAAAATCTGCTTGGATTCAGCCTTACGTCGGGTCCTTCACAGAAGCACCTCGAATTTA
CGTACTCTCGGCGAGGCGATATGGAAGCGCTGGACGAGCTAGGGCGCATCCTACTGAACCTTTCACGCATTGTTCCAGGTGGGGTGGTTGTATTTTTTCC
TTCTTACCGGTTTGAAGAGAATGCAGTGCATCGATGGAAAGCCACAAACCAGTACGAGCAGATTCAAGCAAAGAAGACCGTTTTCAGCGAGCCGAAGAAG
TCCGATGAACTCGCAAATGTGCTAATGCAGTATTCTGCAGCGTGCTCTCAAAGTAACCGTGACGGAAGTGGTGCGATGCTGTTGAGTGTGGTTGGCGGCA
AAATGTCAGAGGGAATCAATTTCAGTGACGAGTTAGCTCGATGCGTTGTGATGGTGGGGATGCCCTATCCAAATGCCCGAGATGCAGAGCTCGTCGAGAA
AATGGCTTTCCTAGACAAGAAACACCCGGGATCAGGGCGACAGTTCTACGAGAGTCTGTGCATGAAAGCGGTCAACCAGTCAATTGGTACGTGCGATTCT
GGTATGCTTCTGCCCCTTCCTCCCTCTAATCCGTGTTCTTTTCGCAAACTTTTCAAACACAACAGGAAGGTCTATCCGCCATCAAAATGACTACTCCACG
ATTCTGCTAGTTGACCATCGATACGCAAGCCCAGCCGTCCGCAGCCGCCTGCCAGAGTGGATTCAAAAGCGCGTTCAACCTCCATCATCAGCCAAGTCGT
TTGGACAGGTGTACTCGCAACTCGTGCAATTCTATCGAGCGAAGGAAAGCCAGGGTCGTCGACCGGTCGATAAATAACACGAAGTCTTCCCGAATTCCTA
TTGAATTCCTTACAATAGATCTGCAGCAATAGGTAACGTTGTGTGAAAAGAAATACTTCGACGAGGGTGCCCGAGAGTGTATGTGACGGCATATCATACA
GACGTCAGCTTGAAGATCATCCTTTATCATTGGGATAAGCTACTTTGCTAGCTGTTTCTTGTATTCAGCGTGAATGACTTGTTTCGCAATGCCCAGTACT
CGACCTGCAAGAGCTTCGTCGTCGTAAGACCATTCCATGTGCACTTCCCACTCAGTAGACACTGACACTCCAACTGTACGAAGCTTCAGCCAACGATCAA
TCTTCTCAATGGCAAGATGGCGAATCCACTTGATAAGACTGGCCTCTAATGCTTTCAGAAGTTCGCCCACATTCGCTTGAAGCTGCTCCTCATTATCATT
ATCTTCATCAGCTGACTCAACTGCAGCTGAAAGTAGAAAAGATAGAGCTGATGCGGGGCGGGAGCTTTTCTTCTTCACCCGAGGCGAAGGCTCGAAGGGC
TTCTTCCAGGAGTACGAGAAGAAAAGTGAGTGTTTCTTCTTTTTCAAACGCCGTGCGCCATTGCCAGCTGACACAAGCATCAGCTTGCGCTTTGGCTCAG
CAATCAACATACCCTGCACATCCGAAGGGTTGTTAAACATAGCCTTGTGAATGCGTAGCGGGATATCCCGGGCAGGTTCAATGGGAGTTCGCCCTGTAGG
ATTGACCCCTTTCACAGTCACGCTGGTGTCGACAGTTGGGTCCATCTTCATCTGGTTCTGGACGTGTGTCTGGACAAATGCCAGGTCGTCTGGGACCGTA
TAATCGAGAATGACCTGGCGTGGCGCTACGCGTGATACAAGCTGGACAATGCTCTTAGTGTCCACTTCATCTCCACAAGGTTGGTAGTGTACCCCACATT
CCACGTTCACACCTAAGCGCTTGCTAACGCGCTTACGCTCAGGGTCTGCGTAGAGCAAATAGTTTACTGTGCCCGGTGTGCAATACTCTGATAACACGAT
GAGATTCTTTGGGTCACTCGCAACCGCCTTAATCGCACGTAACGAGTCACCCTGAGAAATGTTGGCTGGTCCTGTAAACAGCACGAACGGTCCAGGTTGC
TGCAGCCGCTTCCAATCGAACACCTGCAGGTCAGCAGCGTTTGGAGACCTTTCACGCAGCAAATTTTGCACCGCATGCGTGCACGTGCGCGACAACAGCG
GCAAGAACCGGCTTGGATACTCCATGGCCGAGTCCGACAGGTAGATCGGACACTGCGCCGATTTCCCGGTAGCATCCTTCATCTGTTGCCAGTGCTCCAG
CAGAATCGTAATCAACTCATGGAAGTACCCGAGACGGTATACAGGAATCACCACTTTGCCGTTCGAGCTGATACATTCCAGAATGACTTTCACAAGCTCC
CTTTCCATGGCGCTCTGCGTCTCCGATACAGTCACGGCAAAGGAACTGCGCGTAATCAGCGCACTCGGTTCCAATCGTGGAATCTGCGCCGGCAGCAGCA
CTCGGCCACCCGTAAGGTTAAAGTCGTTTGCAAACAACACCGTCGTCGTCCCGATCTCCAAGTAAAAAGCACACCCGCCCGCCACATGACCGGAATGGTA
AGCTGTTACCTTGAGGTTCTCGTTCACAGTAACACAGGCCTTCAACGCAACAGCTTTGGCTTTCCTGAACGCCGCAGCAATATCCTGAATGTCGTACGGA
GCTGGCAGGCCGCTGCCTCCGTCTTTCGCCTTGCCGTGGCACCCAGTCCTACAGCACCAAATTGTCAGCACTTTCATAAAATACAGATATTATCTGTCTA
CAATTTCCTATCCCTCACCAGTATTCAGCCAGCAGATGCGGCGCGATGGCCCGCGTGCCGTGCGTCATGAGGACCGCTGGAGGCTGTTTCTGGCTCGGAT
CTTGCGCTGCAGCGGCCGTTGCAGTCGCCCACGACACACCGCACTTCTCGGCTACATAGGGCAGCATGTAACACGCTCCGGGGCGGTAATCCGGCACCAG
AATGGCATCTAAAATGCCGCCATCGCGTTTCAGGAGGTCCTTTAGCTCGCGCCGGTACTGCGTTGTCACCGCCTCAAAGTCCTCGGCGCCCGCATCGTCG
CCAGAGAAGAAGGACACGTCTTTCGCCTCCCCGCAGCCCAGGAGCACCGTCGTGCTCGAGAGCTCGTCGCGCAGGCAAAAAGCCGCGCCATTCCCAAGCC
TCTCCACTGAAAAGCTCATGGTTTTGTTGTACTATGAGAGGGGGCGAATGACCAGATCAGAATCTGATAGAGTCTGAGGAATCTGAGTATGTTTTTGTGG
GTGTCCTTGTAGACTCAAATTGGTCCTCCGTGACCCGTACAACATTTTTTCAGTCTAACCATGTATGCGTATCTATCCCTTGTGGTCCTTCGAGCCTGTA
CAAGCAGCAAGTGGATGCTACGTCCTGCATCTAGAACTTGCCAGCTTGAATAAGTCCGTCAAAATAAGCTGGCAGTTTGTCCAGTGGCAGGAACGTTTTC
TCCATCGTTGCTCGTGTCTGTACCTCAACGAGGCCTTCCTTCACGAAGCGCTTGCCAACTACGACACGATACGGGTACCCGATAAGCTCGGACTCGGCAA
GCTTAGAACCCGGGCTTTCACGCCAGCGGTCATCCAGCAACACGTCGTCCCTGACCAGGCCGGTCACCTTGCCAGAAGCTAGTTGGTCAGCGATATCCCA
TGCAGCCTGGGACACGGGGTCTTCCTGCTTCTTCCCACCGATGGACATGACGAGGACCTTGAACGGAGCGATCTCGGTGGGCCACGCGATGCCGCGGTCA
TCGTGGGAGGCCTCCACTGCTGCGGCCACAAGCCGGCTAACACCAAGGCCGTAGCAACCCATCTCTAGCGGGTGCTTCTTGTTCTTGGCGTCTGTGTACG
TCGCTCCGAATGGCTTCGAGTACTTTTGGCCCAGGTAGAAAACGTGGCCTACCTCGATACCGCGCTTGTCCTCGAGCACTGCAGCGTCGCCGCCATTGCA
GCGCGGGCAGTGGTCACCCGCCTGAGCCAAGCGAAATTGGCCCCACACAGCGTGGGTACGCGTCTGTTGCTGTGGCAGGGCCTCGACAGCCGCACAAAGA
GCTTTCACGGCACGGGTAGCGTGCTCATTATGCTTCAGTGAATCATCCAGGAGCACATGCAGCTCCACAGTGGGAAAATGCCCGCCCAGTAGCTCAGCGA
TCTTCCTTGTGTCCTTGATCACTTCGCCTTCGTCACCACCAATAAACGGCTTGATTGCAAGCTCATTTACCTCCCTGTCGTGTCGAGCAAAGCAAAGAGC
CCACCGGGGAAGAGACTTATCTTCCTCCTCGTCATCGAAAGCCTCAGAGTCACAGCTCTCCACCTGCTCCTGAACCAGCTTAACCGAAAACCCGTGGTCC
TCTGCTGCCTCCTGAAGGTCCATCACAGTCTTCCAGACCTTCTCGTCTCCAGTTCGAGCCTGTTCCTCGAGCTGCGCAATGATGGCGCCAAGCTCTGTCG
AGACCTCGCCATTTACCGTCTGCTCCGAAGATGGCAAAAGCCCCTGCGCTTTCTCCACATTCGCCGCATAGTCACACTCTGCCGACGAACACGACAGAAT
CGCGTCTTCGCCGATACCAGCCAGCACGTGGAACTCGTGTGAGAGATTGCCACCGATATTCCCCGAGTCGGCCTCCACGCGCTTGACCGGCAGCTTGAGT
CTCGAGACCAAGATCTGGTTGTACGCCGCAGTGACGTCCTGGTACGTCTGCAACGCACCGTCGTACGAGGCGTCAAAGGAGTACATGTCCTTCATCACAA
ACTCTCTCGCTCTCAACAGACCAAATCTCGGTCGAATTTCGTCGCGAAACTTGCGGCCGATCTGGTACAGTCGGAGCGACGCGTCTACAGCGCCCGCAGC
TGAGTAATGCGCTGCCACGAGGCTCGTGACGCTCTCCTCGTGAGTGGGTCCGAGCACCAACACGTCTTCTCGGCGGTCCTCGAGCGCCATGAGCTCCGGG
CCGCGGCTCTGCCAGCGCCCCGACTGCTTCCATAGCTCGTGAGCGTTAGCACAGCCAGGTCCACGCGGTTGCCACCAATTTTGTGCATCTCGTCATCGAT
GAGCGCCTCCAGTTTGGCTACAACAAGGCGGCCGAGCGGCAGCAGCGCGAAGAGGCCGTGGCCGCTTTTGCGCACGAAGCCGCCGCGCACCAGCAGCTGG
TGGCTGAGAACCGCGGCGTCTGACGGCGCCTCCTTCTCCGTGGGCGCCCACAACACAGAACGCAAGGCGCAGGGGGCGGCGCGTACCGCCTGGGACGACG
ACAGGCGCCGCTCGGCCGTCGCCAAGGACCTACGGCGAGCAGCCCACATGAGCAGCGATTTGAGCCGCAAAAAAGGCAAGTATCTCTGGTGTGTGGCGTA
CACCACATTATTTTACGACATGGCTTCGTTTTTCTCTGCAATGGACTCCCTTCAACAAGTAAAAAATTGGCATGGGATACTGTCGGAAGCCCCGCAAGAT
GATGAAGGAAGCAAATTTACCCCTGGACAGCGGAGTCGGTCGAGTTCGTCTTGTTCGCTGCAAATGCTGGGCTGACTCATCAGCTGGGGAGAATAGTTGT
TGCTGGTACAGTCGAGCGCCGGAACCTGTCCGACTTGGCCAACCCCGCAGTCGCCTATTCGTGTTCCGTCCCTTGTCGTCACCACGTCCGTTTGCACGCA
GTGTCGGGCTCTCGTCATGTGCGGCGTCGACACTCGCACGGTTTCAGGGCGTTATTGCCAACAAGTCCATTGCCGAGGACAGGTTGCACTCAGGATAGGT
ACACTTGCCCCACAGCAACAGCTCCAACTCGCACGCAACGCATCCAAAGTCCAACGCAAGAGAAAAAGTGTAGGCTGGATATTGTGGTCCGTAATACCAT
GTGCATCTCCGCATACACCGCCACATCCGACCCCGTCTCCGTCCCATAATACCCTATGCCAATTAAACCGGCTGGCGACCTTGACGTTGTCCGAAAAATA
CAAGCAGGTGCCAAGTCCCAGTTTAGTTTCTGCCGCCTCGATCGATGGCTTCAGCTTGGCGCCAGCATCCGCACGATCCGTGGGACCTGCCGTCGCCGCC
GCCGCTACTAGAAGAAGCCGCGCCCAAAGCTTCCAAGCGCTCACACTTTTCACGCCGCAGCACGCGCGCCCAGAGCCAAGCGAGAGCCCAAGCGCAGCAG
GCGGAGCTCGAGGTGGAGGCGCTCGCCGACCAGCGCGACCGACGAGCGCCGCAGCCTCCTGGCCGCCATGTTCGGTGGTCGCAGCAAGTCACGCACGTCG
CGATCGTCCTCGGACGCCCCGCAGACGCTCGTGCAGCGAGAAAAGGCCTTCCGCCTCGTGCGCCACGGCTCGGACCCGCTGCTGAACGACGCGTTCTACG
CCACGCAGGTGCAGGTAGGCAACTTCGTCAAGATGGGCTGGCTCACCAAGCAGGGCCACATGTGGAAGAGCTGGAAGACGCGCTTTTTTGTGCTCTTCTC
GGACGGAACGTTCGCCTACTACAAGAACAAGGGCCGCAAGAAAATCAAGGGCTGCATGCAGCTCAATGACGGCGTCGTGTCCGTGCAACACGTGGACGTC
CGCGTGGCGGACAAGGCCTACGTATTCCAGATAGAGAAGGGGTTTTACAAGCTGCTGTGTTATTGCTGCAGCCAGTTTGAGGCCGAGCTGTGGGTCGCAG
CGCTGCGCTCGGTGCGGAGAGTGACCCCGCCCTGTTACGAGACGGATCTAACGGCCACTGAGGAGAAGGCGGGCTCCAACGCGGTCACGAGACACTTGAA
CAAGATTTTCATCACAGATAAGCAGATCGCCAAGAGTTTGGTGCAGTTCAAGGTGAACGAGCACGACCATTCGTACGCAGCAATTCACAATTTTATTGTC
GAGCTGGACGACGCGATCATTGATGGTCATCACTTGGAGCTCTATCAGGACCCAGAGATTGAGCTGCTGCCTGGTAATGACCTGGTACGGCTGATTCGTC
GACATGTGGAAGATCGAGTGTTTATTCCGTTGTATGCGGAGGCGTACGCGAGCTTGGAGACGGACAAGGTCAAGACGAGGCGCAGCAACCTCGAGCAGAA
CCTCAAGGTGCTGAGGCGGAAAACTCAGGCAGATTTTGGCATCTCGAAGGATTTATCCGTTTGCGACTGGAAGCTAGCCATCAATGTGATTAACATGCTC
GAATGCGTGTCGCTCCCAACGCACAAGTTCGAGGTCATTTTATCAGCTGGAAAGGCCATCACGGAGTCTATTGCTCAATATAACGGCGACCTGTTCGAGG
TATCAGATGAGACGCTGACGGCGGTTTTTCGGTACGTAGTTACAATGCGTCACTGAGCGATTTACCGATTCTGTGAGCGCTTCTCAAGTACGGATACCAG
CACCACCCAGCGTGTCAGAACAAAGCAAACGTCGTTTCAGCTTTCCTCGATGGGATCAAATGGGTGGAGTGCTTCGAGACTGGCGATGAAAGCTATCAGT
TTGATTCTTTAGCGCTAGCAGGGTCTCGCGTGTCGGTATCTATCTCGACTAACGATGTCGGCATTCAGTTTACGACCGATGGCAATGGTAGAGGGGCTAT
TGTTTACAGTGTGCGAAAGCAATCACAAGCAGCACTTAGCGCTTCAATCGTCCCTGGATTGTCGCTGATTGCCATCAACCACGAACCAGTTATCGGGATG
CCTTTCGACAAGATTATCCAGCGCGTGCGAACTGCGGCACTCCCTAAGCAACTCATTTTCATGACCGAGTTTTACTACTACCAGCTTCTTTCGCTGGATT
CGGAGATGTTTCGATACCTAATGTGTATTGCAGCGCGCCGTGGGGACTTGGATTCGGCTGCTTGGCTGCGGTCGTCCACGGTGGAGCTCAATAAACTTTG
CTCGTGGGAAAAATCTCGAGGAAAACAGGTCTTTGGATTCATCCCTGTATCTGGGAAGGGATCCCCACTTCACGCGGCAGTGCATAACGGTCAACTCTCT
ATGGTGAAGTATCTTATCTCAAGAGGGGCTGATACGAACTTGTGCAATCAGAAAGGAAGACGCCCACTTCATGTCGTGAAGCAGTCGATTGATATGGCGT
TGATCATTGAGAGCCTTATTGATGCGGGAGCTGACATTGACGTAGCGGAAAAACACGGTCTTACCCCGCTAATGTTCATGTGCTTTAGAGCATCGCTTGA
AGGTGCCGCGACGCTTGTAGCACTTGGAGCAGATGTTCGCCGTGTTGCATGGTCGAATGGATTTTCGGCTCTGGAGTTTGCAGTGAAGAGTGAACGAACA
GAGCTGGTAGAGTTGTGCCTTTCAAAGGGGGCAAATCCAAATATGCCTACGCTGGACGGAAACACAAGTTTGCATATGGCAGCCGCTCTCCCCCACGCTG
ATATAATCCTCCGGCTCCTACAGAGCGGTGCAAACCCCAATGTTCAGAATCGGTATGGTCAGACTCCGGCCACAGTCCTACTTGCGTCTGCTCCTGGTGG
AGGTGGCGATGCCCGAATCCTGTGTCTGGAGATTTTAACATGTGCCGGTTGCCGGTTGGACAAACGTGATCTCTTTGGTCGCCAGGCTTCTCACCTGGCA
AACATCTCGCGAGATTCTCATGTCATGGGTCTACTTCGAAAGTTGGGATCGTTGAACCGAGCAGGCAATAGCGTTGATGTCGATATCTTCGGTTGCTCAC
CTGTTGATTATAGTCATGGGATCGAGGTAAGCAAGGCGACAGAATATTTTGGATCGCAAATGCCGAACAATTCGTGGGAAATCATGACAAGACCGACCAC
GTGTCTCGATCTGCACTCTCGGGTTCTGTCGAGGATTTGATTCGCAAGTTAGTTGCAGGCACGGAAGTGGACTTGGTGGATGTGGTGGCGTTCGTGCTCT
TCTTGGACAGCTTCTCGAGTCTTAACGAATTGGTGGATCGGTTGAGCGAGCATGTCCGAAACGGGATTAAAAGTAAGTTTTGTGCGTGCTTGTTTGTTAA
TCCTTCGCGCGGTCAATATGCACCTACATTAGACACTAACGTGGCATTTACCCATTTGTATTGTTCGTATAGGCCACGGACTTATCCGTCTCTTCATCAT
GATCCTGCTTTTTAGAAATACGGAAACGAAGGAAGTAGATGATCTGTCTGATCGCTTCTACAGCCTGATCAGTCACAACATTGACGTCCCTAGGGAAAAG
TTGGTACCTCTTGTTGATGAGTATACCTCCCTTTATAGGGAATATTTCTCATTGCGAGGAGCTGGAAACTACGCCACAACTTACGAAAGGATTCCAGAAA
TGATGACTAAGATATACGGCTTGGAGTCAGGCATTGAGTTCGTATCCAACGAGCCCTTTCCGCTTCATTTGCACCGGTAAGTCGAGTGATAGCTCATTGT
CTCCCTTTTGATCGAACATATCTGACCTATGGATTTCGGTCCTCTTTCGTTGGGTAATATCTCAGGTATATTGATGCAGAACGGTGGGCTGAACAGTGCA
CGCTTCTGACGCACGCAGTCTTTTGCCAGATTCCAGGTGGGATGTTATCGTCTGCTTGTTTAATTGGAGGGTTGACTAAACTTTGCTGTCTCTAAAATGC
AGTCCAAGATTTGATTTTGACAGGCTCGAAAAAGCAGCACTCCGTTGAATTTACGAGTATCAAACGATGGTTTCAGCACGTACGTTCTGTTGTCGCTTTA
TATTTACGTGCTAAAGAGATTAACTTTCGGGCGTTTTTGTGCGTGGCAATATTGTGTAGATCTCTGCGTACGTGATCAACGCTGTTCTTGTACAAAACTC
CCCAGAAGAGCGTGCCGAAGTAATTTCGTTTTATCTCAAGGTAAAAGGATATTTCGGCTCGTTTGACCTCTGGTGGGCTGCATGCTAACCTTTGATTTCG
AACTATGATCAGGCCGCCGATTATTGCGTGTCATTACACAATCATGATACGCTGGCTTCGATCTTATACGCATTGCAATCTACTGCGGTACAACGGCTTA
GAAAGTCGATCGATTGTGTACGTTATTACCAGCTATGTTCCTCTCGTGGGCACGAAGTCACGAATTCTGATTTGGTGGTGCATTACAGCTAAGTGCGGAA
GCGAAGAAGATGATGAACGAAATGCAGCTACTTTCCGACAAAGGATGTCGCGAGATGAACCGGTTGATGCGCAAAACTGTCAACCCCAGTATGCCTTATA
TTGGGTTGTATCTCCAGGTAAAGACGCGCATTTCAAAGTGATGCCTTCGGACGAAAATGTCTGACATTGTGCGTGTTGATTTAGGGCTTCGTCGGACTGA
ACGAGTTGCCTGCGTTTGGCAAAGAGGGTCAAGTCAATGCGAGTCGGCTACGAAAAATGGGCGAGTTGGCAATGGAAATCTTGCACCGCCAATCTGTTGC
GTACACTCTTCAAAACGACGAGAGTATTGATGTGAGTAGCAATTTTGCCTGTCGTCGTAATCCTCAGCTGTGGATATCACGTCTAACCTGCGAATGTAAC
TCTTTTGCAGAAACTGTTGCACGTTTCAATGCCGTATTCGTCGGAGGAGAGTCGATATGCTCGGTCATTGGAGGTCGAGCCGCGTGAAGCAGATGCGATT
CCATTGAGCGATCGCGGTTCGTGTGTTGTTGTTGATGACGACCTCGACCTTGAAAATGAAGTTCGCGAGTCAGTTGGCGGCGATGGAACCTTTGGATTCC
GCCAGTGGATTAGGAAGCAGCAAGTCGTGCACCGCAATCGCTCACGCTCTTCGCTGATAGCTTTGTACGAGTGGGTGTAGCTGTGATGTGCTGTCTTCTG
CGCCGTGCTTTGGTGAATACTTTTATCTATTCGTTGTGGAATGTTTTCGCCCAACATTAATACATTAGCATATTTAGTTATCAGCGATGTACTTCTCGAA
GTCTTCCATCGACATCATGGCGTCCGGATCCAGCGATAGTTCAGCGGGGTCCTTTTATCAGCAAATGGCGCTCATTAAGTTAACCACTTGTGCGCAGTTG
TCATCCACATGACCAACGTACCTGCTTGTCCTTGTCCTGCTTGTGCTCGTCAGCACCGAAAAGATCGTTTTGCGACTTTAACACTGGTGACGGCGGATCA
TCCGTCGTCAGGTCTTCCATCTGCTGCATGATTTGATCTCCCTTTTCCCCAAGCATGTAGTCATCTCTTCAGACGCGAACATCACCATGTTAGTGCCGCT
GTTCAATGTCGCTTCTTGTATGCCTCGACGTACAGGAGGCGATTCAGCTGGATATCGCTGGCTGCAGGAACGGTACCATCCGACTCGGGTTGAGACTTCT
AATAGTACGACAATCTCCACAAACTAAGGCCAAAGTACCAATGCTCGTCAATTGTAGCTAATATTGCTGCCCACCTCCGTCTTGGAGAAGAGGTCGTGTG
GCTCTCGGCGCATCTGCGGACGCTTCGTCTTGCTGTCCTTTGTAATATTCTGCCAGTGGTGGATCTTGGTCACAATGTCTCTGACGACACATTCTCCGTC
AATGCAATTAGCACTTGCGAGAGTGATAAACTGCGTCGCCTACTCGTCTTCCTCTTCGTCGGCGAAGAATCCACCTCCGTTGTGGGAATTCGCTTGGTCC
CCACAGCGCGTCACCTTCTTTGATTCGTTCGCAGGGGCAACGTAGCCATCCGTATGCGCCGCATCAAAAAAGGAAAATGCTACGATGAAGGCACGTAAAT
TCACAATAAAATAGTTTGGTCATCTTGTCAGTGCAAGCATTTCGACGCCCTTACTAAATCTCGTCTTGTGCTCCGCCATCTTCGTGGTCAAAGCTTCTGG
AAAAGATCCAATTGTAGAGTGGTACACGGTACCGGTGTTGAAGCTTGAGCACGGTAACTTCGAACTTACTTGCGCGCCGAGCACTGCCCATGGAGGTCTA
TCCACTGGGTAGACCTCTATATAGCCAAGTAGACTTTACTGTCATGCAGAAGTACGCTAAAGTGTAGCGGCTAAACTAATGAGAGCTAGCGTTGGTGAGC
GATTGGATGCTCGTGGAAGGGTTGGAACAAAATGTCGGCTGGATTACAACGTGTACAATAGATTACAGGCCGCGCACATCCAACACGCCTCTCTTGAATC
GCCCCTTGGTAGCCTGCACGCCATAGTCGACCTTCTTTCGCTTTTGGTGGTCTCTCGAGTCGCCGCTCGATTTCCGCTTCCCTGTCACCACGTCCGACTC
CTTCAACTGAGTGGTCGTACAGCGAAAGCAACAGCAATAGTAGCAAGAGTGAACATGCTACAACCGACAACAATCACAAAACACCTCAACCACAAGGCGT
ACCAGCTCCTCGCGACGTTGCTTGCGAGCCACGCCCTTCGTCTTCAATCCGATAAGCACCTTGTAGGGCACGCTGCGGTTCTTCGCCGCTTTGCCACCCA
ATGCCTCGATTTTCTTGGCCTCGTGCGCCTTCTTCTCTTTTCCCTTTAAGCTTGAGCTGGCTGCCACCGTCAACGCCAGGCACCAAAATCGAAATTCCGT
AAGTGGCTCTAATCCCATTGTTCTAAGCTCTGAAAGCTGCAAGACAGTAACGCACCGAACTCCAGCACCGAGTCGAACGTGTCATCGAACTCCTTGCGGA
TCTCCTGGCGCAATGACAACTCAGGTTCCTCTTCTTTGGCTTTGTTCTGCGGCAAAGGAGAGTGTCAAAGTCGAATCCATATCGAAACAACCGATTCAAG
CACGAACCTTGTTCACGCGGGGCTTGCGCTCCTTCCACGTCTCGGTGGGGCACTCGAACACCTGCACTTTCTTCTTCTTACCGCTCGCCACGGGGAACTG
GAACGCCATCTTCGACTCTGGTGATGGTCGACGCCAACCAAATGCTAGCGCTGAACTATGCTATAAATGTGGACCACATAAACATCAAACCGTGACGCGC
GCAACAGATCGATACTATTTTGCTCGAGAAATGCACTATTGTTACTACAGGTTCGTCGCTACAGTTCAGACCAGAACTTGCACCTGGAACAGACCACTGC
TGGCTGCTACACGCTCGTCGCCGTTATGACTGTCCAGCTCGTCCAACTCGTCTTCAGCGTCACTTTCACCTCCTTCGCCGTAGAAGCTGCTTCCGAGGTC
CGAGCCAAAACTGTCCCGTCCGCTGACCGATTCACTCGCGAACGAATCCACCTTGTTATCGCTCTTTGTTTCCTGCTCAAAGTCATAGAAGCCGCGGCTT
TTGATGACGCGGCTGCTTCGTAGAGGATTCGCACGGCGGTTGTCGTTATCACCACGTCTGTCCGCTGCGGTCGGAGAGGCAGTAGCGCGCGGTGCTGGTC
CGTTATTGTTTTGATTTTGCGACTTAGGGCTCAAGGGAACGAAGACGCTTTCACCAACCAAAGACTGGTTTAGCACACTTTCGTCGCACGCTGGGACTGC
AGGAATCGGCCGATATCGGGACAATCGCTGAAAGCGAGGAGACTCCATAGCATTGACTGTCATACGTTTGTCCGGTGTTGGCGCTGAAAAGTCGGCCATG
GACATCGGACTTGGTGGCTTTCTTCGTCGCCCTTGCACTGCGGGGTGAGCTTGGTCGTCCTGAATATTCAATTCTCCTAGGGTCTCGCGAAGCTGATTCA
ACCGTGAGAATGTCTGCGCTTCGGGAACATCGGCTGACCGATCCGGAAGTGCAATACCACCACGAGCAATATTCGATTCAAATCCGACAGACTGAACTGG
TGCCAGTCGATGCTGATACGAAACAGCCTGGTACTGATCCTGTTGCTGAGCTTGCTGCAGGGTTTGTCGAGCCTGCTGGGTCTGGAGGTCCGTGTGGTGT
TGCTCGTTAAGGGCTCGTTGTGCATCAACAAGACTAGCCATTTTCTCGTTCTCAAGTTGCAGCAACGCCCGTTGCACACGCAGTTCCTCTTTCTCGCATC
GAACCTCATCCCGTTCTCTCCGCAGCTCCTCTCGTTCACGGCGAATTTCTACCAGCAGCGAGCGGTACTCATCAATCATACGGCTCTGCTGCTCCAGTTG
CTGGCGTGACTCCTGAGCGTCGTTCTCTTGAGGATATAAATGTCTCCCTACTATGCCATTGGCCGGGCTCCGATCAAAGGTGTCGCGTCCGCCATCATTC
GCACTACTCCGCTCGATACCTAGTTGCATCTGAATCCGCGAAGGAGCAGGAGGAGGCAGCAGTGTTTCTGCAGGGCCCGTGCTCCCATAATGACGGTCTC
TCTGATAATATACCGCCTTGTCTTCTTCCCGTGGGTCTCTGTCGAATGCAAAATTGTGACGACTGCTTGCAGTCGGTTGAAAGTCGTTCCTCTGTCGATC
CGTCAGATCTGGCGGTGGCGGCAACGTATGAGGGTACGGAGAGTTCATCTCTGCCCTATTGTCGTTCAGCTCAGCATTCACCGCCGGTGAGAAATGCCCC
AGTTTCCGCTGCGCTCGCAGCTGCTGCTCTCGGAGGAAGCGCATCTCTTCCCTCGCCGCATCCTCCTCGCCGCGTCGCCGCTCCTCCTGCTGCAACTCCT
TCAGCCGCGCCTTCTCCTGCACCTGTTCATCCAGCATCCTCTTCCACTGCATCTGCTGTGCGCGTTCTCGCAGCCTCTGACTGGTCTCGCTCTCGTCTGT
CACTCGGAAGCGCGGGTGGGACGACGAAACGCTGTTGGCTTCCCCCGTCGCGGCGCCGCGGTCTTGTCGTTGCTCGTCGTGCAGTTCCACGCTCTGCGCG
AACTTCCAGGGCGACTGGGAGGCCGCTGGCAGCTCGAAATGGCCGCCTTCGACCAGCCACTTGGCCGGCGAACGCTCGCTCGGCGCCAGCTTGCGCTCCA
GCTCCTCGCGCTCCATCTGCTCCTGGTGCTGGCGTGCGCGACGCAGCGCGATCTGGTGGTCCAGCTCCCGCGCGTAGGCCTCTCTTCGGCGCTGGATCTC
GCGCGGGTCCTCGTCGTTGGCGCCCGAGTCCGCAGACCACATGAGGGCTCAGATTCCTCCGGCAGAAATTGTCGAACGTTTTGATTTGAAGCAGTTTTTG
AGAGGGAAGGCGTTTGATTGGAGGATAATAGAAATTTGGACTGATACAGCAACCTGACCAGGAACGGACCTTCCTAGAAGTTCAACGAGTTGCCAAACAG
ACACGAGTCGGCGTACTCGCGTCGCAGATCGACCATTAGCTTTTCCACTTGCAAGTCGCTGCGTTGACACTCAGATTGCAGCAGTTGGAAGCGAAGTGAC
ACGTCACTCTGGAAGCGACGCAGCCTCTTGCGCTCCTTCTTGGCCCCATCTCGTCGAGGTCGGCGGTGGTGACTGCCGCTCCGACGTCGGTGCTGTTTGT
GGCTGCTGCAGTCGCTTTCGCTGCTGCTGCCGCCCACGTCGCTGTCATAGTCCTCACTCTCAGCTTGAGGCCCGCGCAGCATCTTCTGGATACGGACGCG
CTCTTTTCTGCGGCGTTCGCACTGGTCCAGATTGCGTAGCAGCGCATCATGTTCTCGCTGCAAGCTGTCGAGTCGGTCCTGGCCGCGCTGGAACGTCTGC
TCTTCTCTGCTGAGCCACTGCTTCTTGCGCTCCACCTCCCCATACAGTTCCGTCAGTATCTCGTGGACTTCCGCGTCGTCGGTGCCACGCGTGTTTTCGC
TCTGCGTCAAGTACAGCGTCTTGTGCTGGGAACTGCCATTGCTTGTCCCTCGACCGCTCGATATTTGCTCCTGTGTGCGCACTCGGAACACGACAGATTT
CTCTGTGGTGCGCACGACACTACGGCGGGAACATCGCTGGCTACTTTGCGTGGGAGACCAAGCGGGGGAAGCACTGCGGCCCCGGGAGTGAGTGCTGGAC
GACGAGCTCGCGGTGCCGCTCATTGATCGTTGCGGTCCAAGATTTGAGTGACGAAGTGAAAATCTCTGTTGAAACCCTTGAACAATTAATAATTTCGCTA
AGTGAACATTAGTGAATTTGTATTGGGAACAAATTCTCAAATCAGGTAGCCTTCTGAAAACAGATATGAAGCAATGTATCGACTTTGTCAAAATTGCAGC
TTTTTGCTGTGCATCGAATTGATTGTCTAGCTGTTGCAAGGCCGTTCCTGTCTAAGCTTCTTGTGCTGCGAGTAGCGATCTTTGCTGGTCACTGCATAGT
CCTCGATGAAGCAACACATTTATAGTTCGCTGTGAGGGACGGGTTTGCTGGTGGGGATCGGCGAGATCATGGGCGAAAAGATGGGGCGAGAAGTGTGCAT
CAGCGCCGTCGAGTGCGCCCCGCCTGCGGAGACCTGGCGGACAGGGATCGGACCAAGGTCTAGACGCGTAGGCACGGCGAGCGGCTTCATATCCGTCAAA
CCCAGTCGTCCGTGGCTGCAAGAGTCAAGAAAAACAGGGCGAGATTAGCGTTTCCTCCTTGTCAAGCCAACTCGGCTGAACAACGTACTCGGGTCGTCCC
GCGACGTAGGCAATGCCGTCGCTCGTGACGAACAGAGTGTGAGAGCCACCACATGCAGCTTGAATCACCGTTTTGCCCTTCAACACCTTCACCTGTTGAG
GTAGAAACATCGAGACGTCAGCAATGATTGCAATACTCAAGCAACCAGCGCTCCGTACCAAGTGAGGTCGCGTTCGACTCTTTGTGTCGCCAAGACCGAG
TCGGCCATACTCGCCACGCCCGAAAGCATAGCAGTCTCCCGACTTGGCCACCACCGTAGTGTGCCAACCACCACATGACACACGCCTGTACAGTCCCGAA
GAACACAACAATCGTTAGCATATTAAAATCCGCACATAGGTAAGCGACAAGACAAGCAGCTTACAGTGCCGGAATGGCATCGAAAAACTCGACTCGTTTG
GGCGTCTGCTGATCGGACGTCTGGCCAACGCCGAGCATCCCGTAGTCCTCTTTTCCCCAAATGTACACGTGCCCTTCCTCGGTCACAGCAGCCGAGTGGA
AAGCACCGCAAGCGACTTGCACGACCTTCTCGCCGTTAAAACCTTCAAGCAATCGTGGTCGACTGACTCCCAGAAGCCCCTCGTCCTCCGTGTCCTTCAG
CCACGCAGCCCCGATGCCCAGTTGGCCGCTATCACCTCGACCCCAGACGTAGACGCGCCCCAAGCTGGTCAACGCAGCCGTGTGCGTCCCGCCGCAGCTG
ATTTTTAGGATTTTTTCGTTTGCATTGCCTTCCGGCATCGGGCACTTGACCGGCAGCGACTCGTGCGCCGCCTCGAACTCCTTGGGCAGACCCAACTGTC
CCCAATGCGACTCGCCCCACATGTACAGCGTCCCGTCATTGGTCACAGCAGCAGAGTGGCAGCCTCCACACGAGATATAATCCACCACGAGTCCATCCAG
CTCAAAGAAAGCGATCTTCTGCGGCTCATTAATACTCTTGAGGTCTCCGTGGCCCAGTTGACCCATCTGCACAAAGCACAAAGCACATCCAGTGAGTACG
TCGAGCAATGCGCGCAAGAGGTGGCGGGGAGCGCACCGATCCCCATCCCCACGAATACACAGTGCCGGCAGCCGTGAGCGCCATCGTGTGGCGGGAGCCG
CAAGAGACCGCGATGATCTCCTCGCCCGCCAGACCGTCAAGCTGGTTGGGGAAGTTGGAGGCCGACACGTCGTCGAGCGCCAGCGTCGGTCGGCGCTTGG
CACCCGTGCCCAGCTGCCCGTCGTCGTTACAGCCGAACGCTATCACCGCGCATTGCGTGGCGCCCGTCGAGATGCTCATCGTCTTGATGCTGGTTGGCGG
TCTTGTTGAATGCAAAATTGAATGCAAATGTCAGCGAAAACCTGTTCAGATCGATTCGTATTGTTGTATTTGTTTGTATAAGTCGTATTTGTACCTAAAG
ATGAATACATAACACAAAACGTACATGTAACTTCAACATTGACGATCGTCCACGGGGACCTGTGTGGACGCTTCCGTTAAAGGAGCGTACATCTGCGCCT
TGAGAATGTGGACTCGAGGGCCGCGAAGTCGACCGCGCTTGCCCTCGAGCTGGCGCTTGATCTGCGCGAAGCGAATAGCGTTCGGGTTCCGAGGCGGCAT
GGTACCGCTCCACGCCTTGGACTCGCCAGTACTTCTATCGTTGCTACTGCTACTTTTGAGTGAGTGCTGGATATGCGAGTGAGTTTCCGGTCCCAAGGCG
CCTTCGTCGTCCTCGTCGATAGAGTTGATTCCGTATTTCTTGGCTGTGTTGGTGAGCGACGGCACGAGCATGCGCGTGGTGCGGTTGATCTGGAATTGCT
GCTTGTACTTAGCCATCAGGCGTTGACGGAAGGCTAAGGCCTTCGCCTGTTGCTCACGCGCCGCCATTTCTCGGCGGTAAGCTTCACGTTGAGTCGGGTA
CTTGGTGCTCACCTGCAACGCTCGACAACGACGGCGACTTGCATCGCCACGCACTAACCGTTGAATCTTCACAGCTGGAGACTGCCGAATACTTTTCAAC
CATCCTTTCTGCCGCTTGTACTCGCGAAATACCACGCGCGTGGTTAGTCCTCGCCAGTGCGCCTGGATACGGCTGACCAGGGCATGCTCGCGACGCAGAA
CGCGCCTCGTGATTTCCAGCACGTTGTTCTCCACCTTTATCAGTGTCGGCCTGCCACCTGATCGACGCACATATTCTCTGTAGTTCCAGTAAAAGACGCT
AAGCTCTGCTGTGTTCGTGTACCAGAAGACCGGTGGCTCGTTGGGTCGACTCGCTAAAGCGTAACTAAGTATCTGCGGTGCCATGAAGCTGATTATCCGT
AGACACCGCTCGATCACCGTTCGTCTCCGCGCCTGCATCCCCCGTACCCGGGTTTGAATCCTTGTGGCCGCTCGATTGATCTTCCGCAGATATCGATCAC
GCGCTACCAGGCGACGACGGAATTCCAGGCGTCCCAGAAATCCCCTCGCGATACGCTGGAGCAGTGCAGTTGCCGGGACACGTCGACGTTCGAACTCCTT
GATGGCATTTCGCTCTTCCTCGATCTGTTCCTGGAAGCTCACGACCCCTGCGCGTAGATACCGAGTGCTGCCACACCCTGGGCATTTCGGTACTTCTTCA
TACAGAAACGTCGTGTCTTCTCTTTCGCCCAACTGGTCTGCCTTGCGCCGTACTCGCAGCACGTCGATGAACGTCACGCTATTGCATCGTTGGCAGGTCA
GGTACGGTGTCATGGTACTGAGCAAGTCGTCATGGCTGAGCTCCGGCTTTTGGTCGAGAGCATTTTCGACGTTATCAGGAGTCGTGTCGACAGTCGAAGC
TGCGTTTGGTGAAGGGATCTCGGCATTAGTCTGAGCGATTGAGTCGCTGCTCGCTGTTGGATGTGGGTTGCCTGGTTGTGAAGAGTTGGGCATGGTCCTC
GAGCTGCCAGCGAGCCATGGAGTCGGGTCACACTTGTGCACCCCTTCGCTAACCGATTTTCACGACTGGATACCAGTGGGTGCAACTGAAAATACTAAGC
AAGAGTGGTTCGTGTTTCATGTGCTAAACGCAAGTTGTGCAGCCATCCAACCTCATTCGTCGTCGGCGATGTCTTCTTCCATTTCGTCCTCAATCTCATC
GTCTCCAGGACGCCCCATCTTGTCGTCGCGCGAGTTTGGACGACTCATTTGCGCCTCACGAGAACCTGGGCGACTACTGGGAGCCTCACGCGAGGCAGGA
CGCGATTCTGGGCGACTGGATTTGGCATCACGCGAACCGGGTCGGTTGGACGAAGCAGACTGCTTATAGTCACTGGGCGAGGGTCTGCGGCGTCGGTCGT
CACCCAGAGAAACGCCTAACTTCGCTTGCACGGACTCCACCACCCGTGGGTCGACGTAAGTCTTGATTGTGAGCCCCTTACGGTTCATCTCCTCCATCGT
CTCAAAGCTCTTGTTCAGCTCGCCTTCTTCGTAGTACGCTTCTGTTAGCATTGCATATGCGTCGCCCACACGGATAGCCTCCTCAATACCTGGTTCCTCC
AGCAGTTTGGTGACAATGTCCATCATCTCTTTCGGGTTGTGCTTCACTTGCTGTCGGGCGACGACGAATTGCTCGATCAGCAGAATGCGCTTCTCATAAC
GCTTCAGCAGTGCTTCCTTGCCGTCTGCGCGAGATTTGGACACCACCTGAACGGCTTCTTGCAACGCAGAAATTGCCTTCTCGTAGTCGCGATATTCCTC
GATCTCCACCTGAGCACAACCGGCATAGAAGGCTGCAAGCTGCTCGAATGCACGTGCTTTAGTGTAGAACCCCATGATATTCTTCAGGATTTCCGGGTCC
TTGCGCCAATCCAAATTCTGCAAGTAGTTCGCAGCCAGAACGAAGATTTGGGCGTTGCGCGATACGTTAGCAAAGAACACGACCTTCTCAGTGTCGCCGG
ACTTGAGCAGACATTTCATGGCCTTAAGCTTGTTGCCGGCTTGAGTGTACTTCTTCGTGGCCAAGTGATACGAGCCTTGCTGCTTGCAGCACTTGGCAAG
CTTAAGCAGTAGCTCAGTGCGCTTCTTCTTGTCAGCCGGCGACGCGGTGTCATCACCTTTGGGAGGCGTCATCTTCTCCGCCATCTCTTCAGTAACCTTC
ACATCGTGTTGCATGCACACATCCAGAGCCTCTGCAACGCGATGTCCGATCAAGCACAAGTGCACGGCCTTAGCGAAATGACCGTTGGCGATGAAGAAGT
CAGCGCATTTTTTCAAGATAGCGGGCGAAGTGTTGCCAGAGCCACTGAGTTCGTCCGTGAGGTGATGCAGCTCCTCAAAGAGTTGGGCCTGGAAACACAA
ATCGAGGGCCCTAGCCACGTTTCCTCCTTTGTGGTACAGCTGGACGGCTTTCTCCATTTCATGTTGCTCTTCGAAGTATGCAGCACAATCAAGCATATCA
CTGGGCTTGCTCATGAGCGCGAAGCCCATGAGGTCGGCGTCCATGCGGTGCTCCTTGGCCAGACGAATGGCATGGTTGTAGCAACCACCGCTTGCGAAGA
AATGGATAGCGTTGGAAATTTCGTTGTGCGCCTCGAATTGCCGGGCCAGATGATACGCTGCTGCGCGATTCCCGCTCGTCTGTGCTACTTTCGCAGCCGC
CTGGAAGTCTTTCTTGAAACACAAGACGCGTACAATGGACAGGTAGTCCTTGGCACGCTGATAGCTTTCTACGGCAGCATCAAATTGTCCCTGGCTCTCT
TGGAACTGAGCCCACCAAATTAGCAGGTCGCGGTTGTTTGAAGTTGCTACGTACTTCTGGAGTATGTCCACCTTGCCCAGCTTGAATAGCATGCGAGGAA
TATCCTTTTGATGAGTGCCAGCATCCTCGTAGGCTTCCATCGCCTCCTTCAGATCTCCCATTTCCTCGTAGTGTCGTGCCAGTGCGTGGTAAGTTGTCTT
GAGATGAATGCGGTCGCGCTTGGCCGCTACATCAACAGCCTTTTTCCAGTATCCGCTGGCCTGATAGAGTTTGTTCAGGAGGTCGTAGCGGCCGCACTCG
CGGTACAAACGGGCTGCATCGTCGCGAAGGCCTAGTTGAATTGCTACCATGGCAATCGCAACTTCGAGCTCAGGTTCTCTCTTTGCCTCTTGCACTGCAG
CCGCACCTCGAGCATGGCCCATATTCCCGAGACATACCTCAGCCACATCCAGCCGCTTCGTCTTCACGCACATGCGCGCCATGTTCTCCCAGACGGACGG
ATTTTCAATGAGTTTGACTGAGCGGTACGCTTCATCCATATTACCGACCGTCATGAAGTAGCAAAAGTCGATTAGAGCTTGCTTCGCCTCATTGTTGACC
TTATCCAGCCCCGTGAAGTCGCGCATGATCTGTGTGCGAAGATAGCTAATGGTGTCGTAAACCATGGGAGTTTTAGTGACGGGGTTGTTAGCCTTGGTCC
GGCCAACATGCACTACGGTTGTGGAGTCATCTGATGAGCTGTTGTCCACCTTTGCCACGAAATATACACGTGGAACTTGAATACCTAGTAGCGCGGAGTA
CTTCAGATCAAGGTCAAAACTGTCTTGCATCAGTAGGCCGTGCTCGTTTGACGCAAAAATGATGGTGACCTCCTTGTCTGAGACTTGGTTCCCGCGCGCA
CCACCGGGACCACCAGTCCCCAAACCGTCGTCGGTACGACCAGCAGCAGCTCCACCCGATGTCGTCGACGCACTATCATTACCTGTCTTGACAGTCTCGC
AGATAAGCAACCGTGGCTCTTGAGGATCGAAGAAAGCTGAGGTCGGGTAGCGTGAAGAGCCAAAGTCAAACTGCTGGTAAATGTTGAGATCCGTTTGAAA
CAGGAAAAGCTTGTTCAATGGTTCTCGCATTAGCAAAGCACCTTCAACGCGGTCAGCAAGAATGCAGATGCGAGTGCCGTCCGAGTTGACACAGATTGCT
CGCATCACAGCAGACTTGGTCTCTTCTCCAAAAGCTTCGGGGAGATTTCCCATGCTTCCTAAAGCTTTGGGGTCACGGCGGGATACGTCGAATACGCGCA
ATAGGCCCCGATCCGTACCCACAGCAAGAAACTTGTTCTGAAGTGACAGCATCGCCGGCCGGCCTTCGGCTTCCGTGAACGAAATGGTGTTTTTCACTAC
TCCTGCAAGGTTACAAACCTCGACATGATTTCCGTTTGCCCGATAAATGGATTCACCGCGAAGCACCATAGCACTCGAAAAACACTTGAACTGATTAGTG
ACTTTGGCATCTCCATCTTTCATTTCGTACACTTCTGCTTTTGATCCGTTCCAAACAACGAGCGTTGATCCGTCGTGGGAAACACCCTTCACACATAGCG
ATGCTTCAAGTGTCGACTGTGTGATTGTCACACCAGACTGCGCTCCATCTTGGAACTTCTCGATTGAGAGTGTCTTCGGTCGGATTTGAATGACTGATGT
ATCTCCACTAAGTGCACGCTGCATGTTGCCCTCATGTAAAATGACCACTCCTTCGACGGTGTTGGCGTACAACGCAGGGTGGGCATTGCTCCAGCCGATA
CGTGTGACTGCACGACCCACTTCTGCCGTGAAGAGCAAGTCCCATCGGTACGACACATTTGCGGAGTCTCCAGTACCTTGCGTCGTGTCAATGAAAGACG
TGGCACGCCAAAAGAAAACTGCCCCTTGAGCTGTACCCGCCACGAGAACGCGCCTTCGCGGGGAAAAACTCAAATTGTTGACGTTGTAATTGAGTCCACT
TGACTTTGGTAGACTCAATACACTGTTCTCTTCAGTACGAATGTTCCAGAACCGCACAAGTGGTTCGCCAGACGCAATTGCTAGTAGCCCCGGACTAGCC
CACTTTGTTTCCAGCAGTGAACCTTCTCCCGCTAGACTCAGCTTGACTTTAGTAATTGGCTTTACTGTGCCGTCCGTGACGCCCACTTGATACACGATAA
GCTGCACCGCCCGTGTGATGACAATGAGGCGGCTTTGCTCCTCGAAAAACATCATCGACTCTATTGCGTGGTTTAGCACCTGAATGTCCGAAATGTGGCC
CAAATCGTCGGCATAGTGTACAGACCCCATCTCACCACCGAAAAAGAACTGTGGACACGCGTGCTGAGAAAAATGCTCCCTAAGCAACACAAAGACATCA
AATCGAGGCAAATTAGCGCAATAGCTAGCAGAACCATTATGGAAAGTAACATATACTCACATTTTGGTGTGGCTGTCCTTTGGTGGCGCTGATCGAGTGG
CGAAGACACAGTGAGTGAAGCTACCTTGACGCGCATATTGCGTACTGAGGGTTAGCTGGCACCGACTATCCACCTTCCACACGGCAAATATTCCGTTCTC
ATCCGCAGACATGAGTCGATTCCCTGACGGGGACCACTTCAACAGACACACGCGGCTCGTGTGCGGCGAGTTCACTTCGCGCGCCGACTGTTCCTTGAAT
ACCCACAGCGAGACCATACCTGGCCCGCACAAGCCAACAAGACTCAGTGCGCGTTGATAGTATTAATTCAAAGGCATCCAACATACCGTCGCTCCATCCG
ACCGCGACAGCTCCGCCACGAGGCTGCCAGGCCATCGAGACGATGTCGGCACTGCGCGAATAGCTCTCCAGACCTTGCTGCTTCTCACCCTACATCGAGT
AAGGGACCATGCAACCGGTTAATGCTTCGGATCTATTGGTTACCCACCAAACTATTTGCTGCCAGTACCTCATCCGTGAAGAAGTGAATCTCTCGGTTCT
CCAGCGCCACGGCCAGCACCGGGTCCAGCTCTCCCCAGACCGAGCAGACCTGTCGCAAATTCGCCGGCACCTGCACATTGTAGTCGTAAAACAATGCCAT
CGTGCACTCTCTCGCCTTGCCGCCACTAGATCTTCGAGTGCATTGCTCGCGTCGCTTCAAGATACAATATGCATTTGCATAGGTATGCTTCACATGGTCA
TTATGTAGTCCACATTACGTGGTGTCTACACACACCACATTTGATCGAAGTTTGACTGGTTGGGCGGCCACTGGTCGTGAAAGGCTGCGGGGCATTGCTG
CATACTCAGGGACTATGGCGGTGCAAGCGAAAACGTCGGAGCCCAAGGGCAAGAGCTTCACCAAGGCCAAGAGCTTCACCAAGGGCTTCAGTGGCAAGAA
GCGCCCGGCCGGTGGCAATGGCGAGGACGGCAAGAAGTCGTTCATGGACCAGAAGCTGGCCAAGAAGCAGCGCAAGATGCAGCGCCCGCACTACGAGATG
GTGACGCGCGCCAAGCAGATCTGGAACGTCATCCGCGAGCGCGACGTGGAGAAGAGCAAGCGTGCTACGCTTGTGGATGAACTGTACACGCTGGTGAAGG
GCAAGATCTATGACGTGGCGGCGAAGCACGACGCCTCGCGCGTCATCCAGTCGCTCATGCAGTACGGCAAGCCCGAGCACCGGTCGCAAATTGTGCTCGA
GATGAAGGAGCACCTGATTGAGGTGGCCAAGATGCAGTACGGATGCTTCCTCGTGCAGAAGATGATCCGCTACGGCAGCGTGTCCGACCGCGCCGCCATC
GTCAAGTGCCTCTCAGGCCACGTTGTGCAGGTGGGCACGCACAACATTGCGGCTAATGTGCTCGAGTATGCACAGGAGTATCTCAAGCCGTCGCACTTAC
GGCGCTCAAGCTCGAGTTCTACGGGCGCGAGTTCGCCTACTTCCACGAGGAGAGCAAACGCAACCTGGCTGACATCATCGCGGCGCACCCGGACAAGAAG
GCGGACGTGCTCAAGCATCTGAGCACCATTCTCAACCGCATGGTCGACAAGCAGCTTCTTGGTTTGGCCTTCGTGCAGTCCCTGCTGTGGGAATATCTGT
GCAATGCTGAGCACGACGACGTGATGCAAATGGTGGCGAACGTGCGTGACGCTTCGTTGGCTCTGCTGGCTACGCGCAACGGTGCTCGTGTAGTGAACAA
GTGCCTGTCGCTTGGTGCGGCCAAGGACCGTAAACGCATTATTAAGGCTCTCAAGGACAAGGTGCTGGAGGCTTGCAACCACCCCAGCGGTTACCTTGTG
ATCATGCGCATCCTGGATGTCGTTGATGACTCGGTTCTTGTGCAGAAGTCCGTTCTGGCGGAGATGAACGACGAACTCTTTTCGGTGGCGATGCACCCGA
GCGGACGCAAGGTTCTACTCCAGCTGCTCAGCCCGTCGAACAAGAAGTACCTTTCGCCGGATGATCTTGCCCTGTTGGAGCCTCCCATGCTTCCGTCGCC
TGAGGACCCGAAGGTCTTGGTGGTGAACTACAAGAAGGACCCGGACGCTCGTCGCGAGGAACTCCTGAAGGGTCTCCTGCCCAAACTGGAGGAGATGTGC
GTGGAGAATGCCACTGCCCTGATGCGCTCGAAGGAGGGTCGTGACGTGATTGTTGAAGTTGCGAAGCGAAGTCAGAGCTCTGATCTGGCGGACAGTGTGG
CGGCCGCCGCGTTGGCGGAGCCTATCGAGGAGGAGGAGGCGCTTCACACTGATGCTAATGGCCACTTTGCTTTGCGTCGTCTGATCAAGGAAACTTCGCT
GGCGGAGCCTCTGCTTTCGGCCGTCGAAGGTCAGCTTCCGCAGTGGGCCTCCACCAACCGGGGTTCTTTCGTGGTTCTTGCTTTCCTAGAGGCTGAGAAA
GGACCCAAGAACGCTGCTAAGGTCGTCAAGAAGGCGCTCAAGCCTGCGATGGGAGACTTGAAGAAGCTCGTCGACCAGCAGAAGGGCACTAAATTACTTG
TCGAGAAGCTCCAATAGAGAGGAGATAGCTCAAACTTTATAGATCCACAGGTTTTGTTTTCGTTGTGCACGCTCGTTTGGGTTTCGGACAATATCTGGAC
TACATTTAATCCTGGTCGTCGCTATCGTCTTCGCTATCGTCGTCCTCAGATGTATCTGTAGCGCCACCTTCTTCTTCGTCGCCCTCCTCGTCGCTGTCGT
GAAACGCTACAATGGGGTTTCCTTCTCGCCAATTCTTCACCAGCTCCAAAATTTGTGGATGCTTGTGCAGAAAAGCGAGGTAAGAGAGCGTTTCTCCAAA
CTATTCGAGCATTGTCTTGGGTTAGCGGGCATGTTTGATGATAACTTCAAGATTTTGTTGAGTTTACCTTGTTCGGTTTATCCGCCAGCTCGGCATCGCA
CTGCTGTAGCATGTTCATCAGTAGATTTACGTTGCCACAGGTGGCCGCGTAGTGCAAAGCTGTCATGCCTTGGGCCTGTCGTACCACAACGACCGCTTAC
TCTTAACCATTTCTGCCGAATAATGTTTTCAGAATTTTGCTGTGAGTCCTTGCACGTACATCTTGTAAGGTGAGATCTGAGCCAGCGTGCAGGAATACCA
TGCCTAGTTGGTGTAGAGGTGTTCCTCCTTCAGCACAGAGCATCAGTGGCGACTGTCCAAACACCTATGGGAACGCGTGATAAACAATATCCTCTACAGA
AGCTTACAATGCAAAGTACCTACGTTTCGTGCATCAACCGAAGCGCCGAGCTCGATCAGGGTTTCTGCTGCGAGCTTGCTTTCACCGACG