Description :
From Genome Similarity Track
Location :
Scaffold_63:39461- 40911
Transcript NameFunction/comments
Phyra_81733Amino Acid/Auxin Permease (AAAP) Family

Sequence
1450 bases(100 bases per row)
GCAAAAGGTTCTTTACGACGGAGGACCTCAAGATCGCTCTAAACATCTTCTGCTGCGTCTACGGCATTGGTACACTTGGCATGCCTGGCAACTTCTCACG
CGCTGGCCCCGTGCTAGGGATCGTCGGTCTAGCGTTCATGGCCTTCGCCAACGTCTACTCCTCCGTTGCCATCTGCCGCGTCATGCTGTTGGCACCTAAG
AGTGTCAAGACCTACAGCGACCTAGGCGAGTGGTGCATGGGCAAGTGGGGACACTGGCTTGCAGTCGTTTCGCAAATGGCCTCGTGTCTGCTAGGCCCGT
GTGTGCTACTTGTGCTGGGCGGCACCCTGCTCGACGGCCTCTTCCCGGATGCCTTCAGCACCACCTACTGGATCTGCTTCATGGCGCTCCTGTGCCTGCC
CGTTTGCCTCATCCCGACGCTCAAGGAAGGTGCTGGGGTCGCTTTCGCTGGTTGCGCGGGCACGATCATCGCCGATGTTATTGGCGTAGCCGTCGTCATG
TACTGCATGCGCGGCCACCCGTCTGCGCCGTCGCCCGATATCAAGTTCTCGCAGGTCGTGGGCATGTTCGGCAACCTGGCAGTCGCGTACAACGCGGGTA
TTGTAATTCCGGCCCTACAGCGCCAGCACCGTGAGCCGACACGCATGCCCCGCGTGGTGTTTGTCACCATGGGCTTCATCTCGTGCCTGTTCCTGATCCT
GGCCAGCACGGCGTACTCGGCCGTGGGTTGCCAGATCACGGGCAACATCTTGTTCTCCATCTACCCGGACTCGACGAGCGGCCTCACCACGCTGGGCTTC
AAGTCGAACTGGGGCGCCGTCGTCATGGCCTACTTTTTCATGCAGCTGCACATTACGATCGCCTTCTCCGTCATTCTGAACCCGCCATTCTACCTTGCCG
AGCGCCTGATTCTCAAGATGCACCAAAAGAAGGAAGATGATGTGGAAAATGCTCTGATGTACGGCGCAGCAAACACGCCCAGTAAGGACAGCGACGGCCG
CCTCTCGTCCAAGATGTCGTACATCTCAAACGCTGACGCCGAAAACCCGTACCTTGACGACATTGAGGCAGAGGCTGCCGAATACCGCGGCGCAAACGCG
ATCAAGTACGTTATCCTCCGTGTCGTTATCCTGGTGATCCTGGTGGTTATCTCGATCATCTTCCGCGACCATTTTTCCGACTTTTTGGATTTCGTTGGCG
CTTCGTGTATCACGCTGATCAGCATTTTGTTGCCCATTATCTTCCTGCTCACGAAGCTTTGGAACGAAATCCCGATGTGGGAGAAAGTCCCTGCGTTGTT
TGTTGTCGTCATCTGCAGCTTCCTCGGCTGCTACGTAACGTACACGTCTGGCAAGGCACTGTTCGCGCCGACCACCTCGGACGTGCCGTTCCCGTACTGC
GACAGCGAGTACGAGAACGAGGTGTACTACAACTACACGGCCGTCCACGA