Description :
From Genome Similarity Track
Location :
contig_38:394584- 431874
Transcript NameFunction/comments
g8790.t1hypothetical protein
g8791.t1hypothetical protein
g8792.t1hypothetical protein
g8793.t1XP_009515436.1 hypothetical protein PHYSODRAFT_469968 [Phytophthora sojae
g8794.t1hypothetical protein
g8795.t1RAW41877.1 putative ATP-dependent DNA helicase [Phytophthora cactorum
g8796.t1hypothetical protein
g8797.t1XP_008911572.1 hypothetical protein PPTG_16044 [Phytophthora parasitica INRA-310
g8798.t1hypothetical protein
g8799.t1hypothetical protein
g8800.t1KUF78859.1 E3 ubiquitin-protein ligase HERC2 [Phytophthora nicotianae
g8801.t1hypothetical protein
g8802.t1RAW41903.1 hypothetical protein PC110_g1893 [Phytophthora cactorum
g8803.t1hypothetical protein

Sequence
37290 bases(100 bases per row)
TGTTGGATTTGCTTCTTGGTGGGGGCGTTGCCCATCTTCTTCTTGCCGACCGCTACACGCAGAACCGGTTGCGTCTTCTTCCGCTGCTGCTGCATCTTAA
CGACCGTGACCTGGTGCTGCTGCTTTTTCGGCTGCGGCGCCGTCTCCTCCGCCAGGTGCGTGAAGCGACTGGACAGCGGGACGGCTGACACGCCGATCAC
GCCGCGAGGGCCCTTCTTGCCCGGCTGCGGCTGCTGCTGGTTGTTGTTGATCTTGCGCTGGCCGCGGACGGACGCCGCGGGGCTCCGGATCGCCGATGCA
TTCTTGGAGTCTGAGCAGCTCTTTTGCTTTGTGAGCTTTCCATCGGATTCTTTCAGTTGCGTGAAGATTTTATGTTGCGCTTAAAGTTTCACGCACCTTT
AACACCGCGCGCAACTTCGGCGAGTGATTTAAAAAACCGACACCAAGGCTGGCCATGGAGACGCTGGCGCCCAGGTGCAGCGCTATCTGGATGCGTACGT
GTACGAGAACGCGCGGTTCCTAGCAGAGACTCGTGGCGCAGGTAAACAACCGCTTGGATCGGATTTGAACGCACTGAAAGCTGCGATGCTGCTGTTTTAA
ACGCAATAAGTATCTACGTCATTTTAACACTTTTTGACCATTTATCGCTGTTACACGCAGCGTCCGAGCGAGGAGAACGTCTGCTGTTAGCCACGTGCTA
CTACCGCAATGGACAGCAGCTCGGGCGTCGGCGGTGCTGAGTGGCGCCACACGACCGGATAATCGCTACTTGCTGGCTTGCTGCTGCTTCCAGCAGGGAC
AACTGGTCGAGGCGGAGAACGCGCTGCTAGGAGGTGAAAACTGCCACGTCGATGATGCAGAGACAGTTGAGAACATACCTGCGGGAGCTGCTGGGTTGTT
TCTACTTGGAAAAGTGTGCAGGCGTGGAAACAGGAGACAGCAGGCTGTTGCCTGCTTCGTGAAGAGGTGAGACGATGTTTCGGTTGATTGATTTTGTGGC
GAGTTTATTGATCTTTGTGTTTGTGTTTGCGTTGTGTTGTGTTGGCGACGGAGTTAGTTTGGAGGTGGATCCGTTCATGTGGTCGGCGTACGAGCAGCTT
TGCGAGCTTGGAGCCAATCTCGAGGCCTCGAGATTTTTCGGCGCAGCAAGCACCGGATCGGCAAATGAAGTGGATTCCGAATTTTCACTTTGCCCGGAGT
TTAGCGATGCAAGTGTTAAAGGTGGACATCAATTTGGTGATGAGGAAGGACACTACCGCGAGGACAACAACCCAGAGGATCGATCCACGGACGGAACATT
GGGAACACCGGAGACTCCACTTTGTTTTCGCCCTTATACGCCTAAGAGCATTTTGACCTCATCGTTGAGCGCTTCTCGACCTATGGGTTATAAAACACCA
ATTGTCAACAGCAATAACGGGAAAGGTATGCATACAGCGACAGCCGTGAAGAAGCCGCGAATTGCAGAGGATATTGGTGCTCCTGTACGACACAGGAAGG
TTCATCGCGACCTCTCGCAGACAGTGACGAAAAGAACCGAACCATTGCAAGGCTGTCATTCTCTGCTGCTGGCTTCGACGACTCTCCACTGGTACGGAAC
CAATCAATATTGTACTTGAATGTAAACGTAGTGGACTGACTCATTATATTTTATCTGCGCAGAATCCGTCGAAATTAGCATTAGGCTCTCCCATCTCCAC
TCGTTACCGACAAGACTCCTGGCCCTTTCCATAGAGAAGGATCATCACGTAATGGCCGGGAAGAGTTGCTCCGCCTGCTGAGTTCGTTTGGCTCTATTTA
TCAAATGTTGAGTGTGTACAAGTGTCTAGAAGCTCTGGAAATGCTGGAACGGCTTCCTGACGCTCAGCGTGCATCCGGTTGGGCACAGCAACAGACTGGT
CGAGCACATTTCGAAATGGCGGACTACGTGCGAGCGCACGAGGTGTTCTGTGCTTTGCACAGAGCGGAACCGCATCGGATGGAAGGTCTCGACATGCACT
CAACGACATTATGGCATCTTAAGGAGGAGGTGGAACTGTCGTATTTGGCTCAGCAAGCAACAGACTTTGACAAGTTATCGAGCGAGGCCTGGTGTGTTGC
TGGCAATTGTTTTAGCCTTCAAAAAGAGCACGACACAGCGTTGGCCTTCTTTCAGCGGGTAAGTTGGTTCGGTTGTATCACGAGAGTTCAAATTGGCATT
GCTGACGTATCCTACGGTATGTCTGCTATTAGGCTATTCAACTGGACCCGTCGTTCACATACGCGTACACGCTCTCTGGTCACGAGTACGTCGCAAATGA
AGATTTCGAGAAGGCAGTGAATTGCTACCGGCATGCAATTCGTACCGATTCACGGCACTATAATGCGTGGTACGGCCTGGGCGCGATCTACTACCGGCAA
GAAAAGTTCGAGTTCGCCGAGTACCATTTCAAGCGTGCGCTCGAGATCAATCCTCGGAGCTCGCTGCTGCACTGCTTCCTAGGTATGGTTCTACACGCCA
CCCAACGGTGTGACGAAGCCCTGACCACCCTCGCCACCGCCGCCGAGCTCCAGCCATTAAACCCCCAAGCTCGGTTCCAGCGTGCCAATGTCTTGATCAC
CCAACAGCGATACAAAGATGCTCTCGCAGAACTCCATGTCGTCAAGAACTTTGCGCCGCGCGAATCCTCGGTGCACTTCATGATGGGCAAAGTGGCCAAG
AAGCTCGGCCGAACCGAGGAGGCGATGAAGTACTTCACCTTGGCGCTGCACTTCCACCCGAAGGACAATAACCAGATCAAAATCGCCATCGACAAAATCA
ACGAACCGGACCATGACGACGACGACCGCATGTAGCGAGTCATCGATGCATCTGCAGCGCCAAAGCAGTAGCCTACGATATACTTTGAGGTAGATAACAG
CAGCATCAATGAAGCTTTTTCACCGGCCACATAGACATGGCCGTTTTGCTTTTATGTGGCATTTGAGATGGTGCCGCCAACAGTGAAAGTCGAGGCGCTG
CTGCTGCTGCAGCAACTCACGCTGTTCAAGGAGGCGAGCGAGGCACTCACCCGTCTGTTCGAAGGGTTCTCTGAGCAGGATTCCGGGCGCTGCGCCGTGC
TGTGGCAGCTTCTGCAATGGCAAAGCACAACCGCGTCCAGCAGCCTCGAGGATGTGCTGGTCGACTTAAAATCTAGCGGTGACAGCAGCCAGACGGAGGT
GCGTAGCGATATGGAGCTCACGGTGCTGGGCAAACCTGCTCTGCTGTTTGCCGCCTCCATCTACGACGAGGAACTCGCCATGTTGATCTGGTCGGGGTTC
GTCCAGTTCCACGCGCGCTACCCGCAGTTTGATCTGCCGCGGCAGGTGCTGGACAACTCGGACGACTCTTTGGGCTATTCGGCGCTGCATTATGCCGTGG
AAGCGCAGATGACGGACTTCCTGCGTGCTGTGTGCAAGGAGTGACCCAAGCGCAGACAGCTCCTCTTGTCGGCCGAGTTGTGACGCAAGACGTGACTTTG
CCAGTTAACACCGCGCACACCATGGGCAAGAACATTGCCAGTGGAGGCTGCTCGCTGCTTCATCTTGCGGCCAAGAAGGGCGAGTTGGAGATGGTGCAAA
TGCTGATTGCACCCCCGATGCTCATGGACCCCAAGACAGTGCGCGACTGGGACGGCAACTCTCCTGCTCGAGTGGCAGCCATCCACGGACGTGACGAGGT
CGCTGCCTTTCTAGAGGTACGGAAGTGCCAGAGCAGTTTGCGAAGTAGGTATTCTAATGGTTATTGTGGTGACTGCTTAGGGTATCACTGGGGAAGCACC
ATTGAGTGTTTCGGAAGTCGATGACCTGCGAGCCAAGCGCGAGAAGATGGCCAGAGAGCGTTACCTGGCACACCTGAAGCCCCAGGAGTCCATGCTAGAG
CCTTCAGTGTTTGCCAATATTTGGACTCTCGAGGAATCGACGCTGATCAGCGATGAAGTCAACCTCTTGGCCGCTGAGCAGGGTTGGTGCAAGGAACGGC
ACGCGTCTTATCAAACGACGGACATGCCGTGCCACCACGTTGCTGGATTGAACTCCTGGGTGCGCGCGACCTTGGCGGACAGGCTCTTCCCTCAAATTGC
GAAGCGGTACAAGCTCCCCAAGAACCAGCGACTGCTTTTCCGTGACCTCTTTTTCGTCAAATACGAGGCACGCAATGGTGAACGTTCTGAGCTTGCACTC
CATCGCGACGGATCCGTGTTGTCTTTTAATGTGCTACTGAACTCGGCCGACGACTTCACGGGCGGTGGCACCTACTTCGACGCCACAAAACGCACGGTGC
ACATTACACAAGGCGATGCAGCAGTTCATAGCGGAAAGGTTCTTCACGCCGGTGCCCCTGTGCTGTCAGGCATACGCCAAATTCTTGTGGGCTTCCTGGA
CGTCGCCGACTGTGTGTACTGAGTGCCTTCACACTCACAAACGGCGAAATTGAATGCCTTCTATAGGCGTGTCTCCTTCAAGCACGTAGAGTCTCGGACA
CCAATGCTTGTCATCGTACAGGTCGTCTTCTAGAGAAGTTTGGATGGAACTAGTGGCTTTAGCCTTCCCGAACGCAACACCACACACAACATTAGCAACA
CGATCCAAATAATAGAGCATACTTCAAAGTAGACAACTGAGACCATAACGTACCCGTTCGAGTTCAAAGAAGAGCAAGCGGTCTTCCCAAATTTTGTCGT
AGTGTTCCCCAGCATCTACAACAATAAAAACAACAGCCGCAGCAGCTGATTAGACATGCTCGTGATGTTCATTGCTGTAAATACTGTACGTACGGCAATC
AAGAGATTTAGGAGCATGATAGTGCCGATGACCACGAATGAAATGAAAAAGATCATTGCAAGCAGACCGCCTTCTGCGATGCTATCCCAATCCCATGAAC
CCAGACTAATGTTGAATGTCGTAGTCAGCGCAGTAAAATAGCTCTTGCATCCCTCCAGCTTCAAGCACAACAAAACCAGAGATATGCTAAATATTTTTCG
TGCTCGTCCCAATATAACGCGCATCGACTGCATCGTACCTGAAGTATGAAAAACGCAAAGGCAAAGCCGCCCAGGAACACGCAGAATACCATGAGGAAAA
CCAGGATGTCGGAGAACATCTGCAGAAAGGTGAGTGCACAGTTAGCCCGGAGTTAGATACATTCCGTTGGACAGCGAACCCAACCTTCGCAATCATGCGA
ACAAATGGGCCGAGTGCTCTGGTGCCTCGTGCAAATTGAATCCACTTGACGAAGATTTGCGGTCCGACAATGCTCATAAGCGTGATACGGAAATTGTATC
GCCTTCGAATGTTGGAGCTGTACAACGATTCTTGGTAGACGATGAGGCGGAAGTCGTCGTGATCGAAGTCTTGAATGAACACGAAGGTGTTCGTTAACCC
TAGAGTTAAGCGAGAGGAAGAAGTCACATGTACCATCAATTTACCTGGAAATATGAGCTCGAGGATCTCTGCGACGAGTAGGAGCCATACACAAGCAATT
TGCACCAGGTCGAACCAATTCCATCCATCTCGTAGGTATACACGAAGACTTCCGCATTCTCTGTATGCTTGATACTAATAAGGACACAAAACAGTTTAAC
CCGCGGAAACCAGTGCCTATGGGACTACAGCATATAACTGTACCTCTTGGAGCGTGTACTTCGCGTTGATGACAGAGTAGACGAGTCGTGCTACATCTCG
AACGTATTCCATGCACCCAACCGTTTCGTTGAAAATATTATTGCGATAGCCTCCAAGTGGCATTCCCACAAACGTGTCACCCACATGCAAGTACCTGGGG
TCCAATCCAGGTGTCAGCTGTTGCTAGACTTCATTGCCCATACACAATCAGAGAGTGGACGTACGTGGCAACGAAAACGGCAACAAAGTAAATGAAGTAC
ACTTTGAACTCGGACCTAAATGTCTGTCGCGTGAAAGAGTTCCATCTGCAGTGACAAACTTTAACCCCAAGCAATTTATGACGTCATTGCAATCATTACA
TGGCGATACGTACTTGTGGTCCAATAACTGTCGGAACCACGGGTGGAAAATGAGATCCTTGCATTCTGTCTGTCCCCCGTTAAGTCACGTTGATAGATCG
TCAAGTTGGCTGATTAACCCAATCCAAAGATTAAAGCACCCTACCTGCACTATCAGCCACAATGTTGGGCTGTGTCGGCCCCGAAACTCTGCGTGGTCGT
AGACATATTCATACAAAATTCCTTTGGGCTCGCACACAATTCTTTCTTTATGCCCAGTTTCATTCTCCGTCACAGTAAACACGTGCTGGACGCTCAATAC
ACTCCTGATGTGACGCAGAAATTTCCACACTTTCTTCAAGGTTTTCCTCAACCTGTCGACTACGCGTTGCATTACACCCTGACTTCGCTTGCGTCGAGGA
GAGCGACCAACTTTTCCCTGGCCCTTCATCTGGACGATCAATGCGTCTCGCTTCTCGTGCAATGTTTTGATCATTGCCAACTGTCCAGGATTGGTTGCGT
TCTCGAACATGTCTTAGCATACTGCACCGGAACAATGGAATACGGAACGAATCCATTGCCAACACGGCTGCTTCAGGGACGTTCTGGATCAACAGGTGGA
ACAGTTTGCTTCTCTCGTGTAGCTCCCGTGCTTTGTTCATTTCATAAATGGTCACATGCTCAGACACAACGAGTATACCCAGCGTTTTTCGTGGTAAAAT
TGAATACCCGGGTGCTGACCGGAAGAACATGATGTCACGGCGATTTTTCGTGCATAAGAATGGAGATGTTAGTAAGCTGTCGACGTTGGAGCATGTGCTG
TCATTCGCAGTACCGACAGCGTCGTGACGCGCATTAGCCCTTCCTGCCACAGTTTCAGGCGACACCGTGGCGGTATTTCCAGCTAAGATCTGGTGTTGCG
GCGGATGAGTTTTGGCTGCAGGTGGACGTTTGTGCTGAACCATAGCTCCCGAGCGAATGTTCACTGATGGCAATAGCTTGGCCATCGCTTTTCCATCAGG
AGATTCCACAAACGTCCCTCGCAGGGCAGTTCCATTCACCATGGTGAATGACACATATCGCGACATCCGAACATCGGCATGATTCTCCACGAGATGAAGA
CAAACTCCACGACGTTGACTAGCTATCGCAAAGTGAAGTCTATGCGTGAAAATAAGAGTAGTTAGTGCAAAGAAGTAAGCCGGGGCACAGCGATTTTTAC
GTTGATGTGACCACTAGGCATACTTACGGTGTCTCTCCGGCTTTGTTTTGAGCATTAATGTTCGCCCCATTTGTCAATAGAAGCTTGCACAACGTGAGAT
GCCCACCTTCAGCAGCAAAATGGAGTGGCGTGTTGCCAGCTGCATCTTTCGATAGAACCAAGGGGTGACCACAAATTTGCAAAAGATCCTGCAATGTGAT
GGCATCCTCGTGCAGCTTGTCGAGAGAGTCCGAGAAGCGAGCGAAAGATACGCCAACATTTGCCACGAGAGCTCTCATCTCAACATCCGACTCACTCACC
AGCCGCTTAGCTTTACGCATTTCGAGAATCATCTCCAGCAGGTGAGTGAGTTGCATGAAGCTGTACTTTTGGTATGGAGAGTTCATTGGGTGCTCGTTCC
AATGCATGATCAGCTCGCTAACGAGAGCCGTATATCCTCGTTGAGTCGCTGCGTGCGTCACCGTGTACCTGCAAGACGAGAAGCTTCAGTATACTGCATC
AAACCGTCAATGCAGCACGGAGGTACGTACTGAGCTAAACCGTGTGGTTGCAGGAGGTCGAGTCCGTCATTCGCTTCGTTCCGCAGGATCCGAAGGATCT
TTGGTAGATTAGGTTCTGCAAGTCGAAGGACGCCGCTTTCAGTCCTCATTGGTCCAGGCACAAGTGGTCTGCATTGGCAGCACTCATCAAAGAGTAGCTT
GCTTTGCAGCGCGAGGTGCTGTTCATCTCGCTTCTCCAGCAGTAGGTGCATCCGATAGTATCTACGCATGGCTCGGTTGATTTTATCCGCCGCCCAGCCC
TCGGGTCGCTCATCATGGTCATGTCGAAACTGACCTGCTAGGAACTTCTTGATGTAGTTTCCGCCTTGCACCATGCGCGTCGGACTCTCCTTGATTTCGT
TCTTCCCTGTGTGCGGGGTATTGTAACGAATGTGCTGCGCTCGAATATGTTCTTGCCTGAGCTGCAGACGTGGAGGTCGTTTGCGCACGTCTTCCAAAAT
CACCTGCTTATGCTGCCTCTTCTTGTTCGCTCGAGCCTCCTGCTCGTCCACGCAGCAAAGTCAGCAAACAGTACTAAAAGCCCTCCAATTCGATCAAAAC
GCCACCTTGATATGCGCTCGATACGCCTCCAGCATCTCGTCACGCGTCGCCGGAATCCCCGCAGACTGCATCGCCGTAGTGTAGCGCTTTGCAGACTCGG
ACGCCTTCTCCAGATTCTCAAAGATCGCCCAAAAATTAAGACGGTTTAGATATGGACTTTCGATTTCCATATTTAACAAACACACTATCGGAAGTGTCGT
ATTGATTTGCTTTTTGTATTACATGTACATTTATTGGCCGGAATGGTGGAGGACGCCTTAGCTGCTGCATCCATGGACGGCGAGTTCTTCTCGTTCCCGT
ACACGCCGTACTCCATCCAGCTGGACCTGATGCATCAGCTGTGGGAGACGCTGGAGCAGGGCCACTGCGGCATCTTCGAGAGTCCTACAGGCACGGGTAA
GTCCATCAGCCTCATCTGCGGCGCGCTCACATGGCTCACGAGGCACACGGACGAGTTCGGACTGCTGCAAGCGCTGGGGACTACAGATAAAGTCGATGCA
ATTGATACGGAAGCAGAAAAACGCAAGAAAATTGCCGAACCGAGTTGGCTCGACGACTTCGAGCAGAGGAAGGCGGATCGGGAGGTCAAGTATCGCCAGC
AGGTGGCTAAGAACGCGCTGGCTGGGATCAGGAAGCTCCGACTAGAGCCGGAGGCCACCACGAAGAAGCGCAAAATGCGGCATGCGTACAACCATCAAGA
GCGGAAGCGGGTGCATCAGGGCAGCAGCAAAGTGACCAAGGACGGAGAAGACGAACACTTGGTGGACGCCTACGACAGCGATCGTGTAAGTCGCCAAACT
AGTGACAATGAGGAAGAGAGCGGCGGGGGTTCGCTGGGGGTGAGAGGTCGTTTTGGAGACGAGAAGCCGGATTTCGGCGTCGTGAAGATCATTTACTGTA
GTCGAACGCACTCGCAGATCTCGCAGTTTGTCAGGGAAATACGAAAGACGGTGTTTGCGGAGCATATCCGAGTGGTGTCTCTGGGCTCTCGCAAGAATTT
GTGCACAAACCCGGATGTTACGAAGCTGGGCTCGGATTTGAGAATGGCGGACAAATGTCTGGATATGATGCAAGGCGGCAAGAGCAAGAACGGCAAGAAA
GTCGGCAAGTGCCCGTTCTATGAGAAAGAGCTGCTCGGTCACTACAAAGACTATGCCCTCGTGAGTCTCGTGTTTTATTTATTGTTTTTGGTGCCTGAGT
GATTAACAAGTTACCGTTTGTGCAGGCTGAAGTGCAGGACATTGAGGACCTGCACACGCTGGGTGAAGAAATGTCTATTTGCTCGTACTACGGCACTCGT
GAGAGCATCTCGCTTGCTCAAATTGTCACGGTGCCGTATTCCATGTTACTGAGCAAAGATACCCGGGAGACACTGGGCATTGCACTGGAAGATAACATTG
TCATCTTTGACGAGGCGCACAACATCATTGATGCAATCAACAACACGTACAAGGTCGAAATCACCAGTAAGCAACTGGTCGTCGTGCGACGAAGCCTATG
GTCTTATTTCTCGAAGTATGAGAAGCGCTTCAAGGGTAAGAACGCGTTCTACATCAAGCAGCTGCTGTCGATCTTGGAGTGCTTGACGAAATTCCTTCGG
CAACTGAGCAAGTCTGCTGGAAAATCCTCATCGACAGGTGACGAAGACGATGGCGCCCCAGGAGCACAGATGCTGACAATCAATGATTTCTTGTTCAGTG
CTCGGATAGACCACTTCAATATGTTCAAGATTCTGGAATATCTAAGGGAAAGCGGTCTGGCAAAGAAGTTGATGGGGTTCGTCGAGTCAGCAAACGCTGG
CGCTCCTGCAGAGGCACCGCCGCCACAATCTGTTTTAGACGATACAGACGAAGGCTTCCAGAGCCGGCATATCTCGCCACTCCGAACTGTTGAGGCTTTG
CTAAAGGCCTTGACCAGCGTAGGCGGCGATGGCCGTATTCTCGCACAACCGCATAATGTAAGCTCTGAAGCCCTGTTTCGACGTCGATAACGTGATTCCT
AACTATTGTTTCTGTGCCCAGGCGAGCAAAGGTGTTGAAGGTTTGATAAGGTTCATTTTGCTCAATCCGGTCATACATTTCCAAGAAATCGTGAGAAAGG
CACGGAGCGTCATCCTCGCCGGAGGAACAATGCAGCCGGTGAGCAATAAGTATTCAAATTTGCAACCCTGTATATAACTAACATTTAGCTGCACGGTAGG
TGTCTCAAATGATCGACCAACTATTATCTTCCGTCCCAAAAGAAGACGTTGATTTGTTCTCCTGTGGACACGTGATTCCCCCCGAAAATCTGCTTGGATT
CAGCCTTACGTCGGGTCCTTCACAGAAGCACCTCGAATTTACGTACTCTCGGCGAGGCGATATGGAAGCGCTGGACGAGCTAGGGCGCATCCTACTGAAC
CTTTCACGCATTGTTCCAGGTGGGGTGGTTGTATTTTTTCCTTCTTACCGGTTTGAAGAGAATGCAGTGCATCGATGGAAAGCCACAAACCAGTACGAGC
AGATTCAAGCAAAGAAGACCGTTTTCAGCGAGCCGAAGAAGTCCGATGAACTCGCAAATGTGCTAATGCAGTATTCTGCAGCGTGCTCTCAAAGTAACCG
TGACGGAAGTGGTGCGATGCTGTTGAGTGTGGTTGGCGGCAAAATGTCAGAGGGAATCAATTTCAGTGACGAGTTAGCTCGGTGCGTTGTGATGGTGGGG
ATGCCCTATCCAAATGCCCGAGATGCAGAGCTCGTCGAGAAAATGGCTTTCCTAGACAAGAAACACCCGGGATCAGGGCGACAGTTCTACGAGAGTCTGT
GCATGAAAGCGGTCAACCAGTCAATTGGTACGTGCGATTCTGGTATGCTTCTGCCCCTTCCTCCCTCTAATCCGTGTTCTCTTCGCAAACTTTTCAAACA
CAACAGGAAGGTCTATCCGCCATCAAAATGACTACTCCACGATTCTGCTAGTTGACCATCGATACGCAAGCCCAGCCGTCCGCAGCCGCCTGCCAGAGTG
GATTCAAAAGCGCGTTCAACCTCCATCATCAGCCAAGTCGTTTGGACAGGTGTACTCGCAACTCGTGCAATTCTATCGAGCGAAGGAAAGCCAGGATCGT
CGACCGGTCGATAAATAACACGAAGTCTTCCCAAATTCCTATTGAATTCCTTACAATAGATCTGCAGCAATAGGTAACGTTGTGTGAAAAGAAATACTTC
GACGAGGGTGCCCGAGAGTGTATGTGACGGCATATCATACAGACGTCAGCTTGAAGATCATCCTTTATCATTGGGATAAGCTACTTTGCTAGCTGTTTCT
TGTATTCAGCGTGAATGACTTGTTTCGCAATGCCCAGTACTCGACCTGCAAGAGCTTCGTCGTCGTAAGACCATTCCATGTGCACTTCCCACTCAGTAGA
CACTGACACTCCAACTGTACGAAGCTTCAGCCAACGATCAATCTTCTCAATGGCAAGATGGCGAATCCACTTGATAAGACTGGCCTCTAATGCTTTCAGA
AGTTCGCCCACATTCGCTTGAAGCTGCTCCTCATTATCATTATCTTCATCAGCTGACTCAACTGCAGCTGAAAGTAGAAAAGATAGAGCTGATGCGGGGC
GGGAGCTTTTCTTCTTCACCCGAGGCGAAGGCTCGAAGGGCTTCTTCCAGGAGTACGAGAAGAAAAGTGAGTGTTTCTTCTTTTTCAAACGCCGTGCGCC
ATTGCCAGCTGACACAAGCATCAGCTTGCGCTTTGGCTCAGCAATCAACATACCCTGCACATCCGAAGGGTTGTTAAACATAGCCTTGTGAATGCGTAGC
GGGATATCCCGGGCAGGTTCAATGGGAGTTCGCCCTGTAGGATTGACCCCTTTCACAGTCACGCTGGTGTCGACAGTTGGGTCCATCTTCATCTGGTTCT
GGACGTGTGTCTGGACAAATGCCAGGTCGTCTGGGACCGTATAATCGAGAATGACCTGGCGTGGCGCTACGCGTGATACAAGCTGGACAATGCTCTTAGT
GTCCACTTCATCTCCACAAGGTTGGTAGTGTACCCCACATTCCACGTTCACACCTAAGCGCTTGCTAACGCGCTTACGCTCAGGGTCTGCGTAGAGCAAA
TAGTTTACTGTGCCCGGTGTGCAATACTCTGATAACACGATGAGATTCTTTGGGTCACTCGCAACCGCCTTAATCGCACGTAACGAGTCACCCTGAGAAA
TGTTGGCTGGTCCTGTAAACAGCACGAACGGTCCAGGTTGCTGCAGCCGCTTCCAATCGAACACCTGCAGGTCAGCAGCGTTTGGAGACCTTTCACGCAG
CAAATTTTGCACCGCATGCGTGCACGTGCGCGACAACAGCGGCAAGAACCGGCTTGGATACTCCATGGCCGAGTCCGACAGGTAGATCGGACACTGCGCC
GATTTCCCGGTAGCATCCTTCATCTGTTGCCAGTGCTCCAGCAGAATCGTAATCAACTCATGGAAGTACCCGAGACGGTATACAGGAATCACCACTTTGC
CGTTCGAGCTGATACATTCCAGAATGACTTTCACAAGCTCCCTTTCCATGGCGCTCTGCGTCTCCGATACAGTCACGGCAAAGGAACTGCGCGTAATCAG
CGCACTCGGTTCCAATCGTGGAATCTGCGCCGGCAGCAGCACTCGGCCACCCGTAAGGTTAAAGTCGTTTGCAAACAACACCGTCGTCGTCCCGATCTCC
AAGTAAAAAGCACACCCGCCCGCCACATGACCGGAATGGTAAGCTGTTACCTTGAGGTTCTCGTTCACAGTAACACAGGCCTTCAACGCAACAGCTTTGG
CTTTCCTGAACGCCGCAGCAATATCCTGAATGTCGTACGGAGCTGGCAGGCCGCTGCCTCCGTCTTTCGCCTTGCCGTGGCACCCAGTCCTACAGCACCA
AATTGTCAGCACTTTCATAAAATACAGATATTATCTGTCTACAATTTCCTATCCCTCACCAGTATTCAGCCAGCAGATGCGGCGCGATGGCCCGCGTGCC
GTGCGTCATGAGGACCGCTGGAGGCTGTTTCTGGCTCGGATCTTGCGCTGCAGCGGCCGTTGCAGTCGCCCACGACACACCGCACTTCTCGGCTACATAG
GGCAGCATGTAACACGCTCCGGGGCGGTAATCCGGCACCAGAATGGCATCTAAAATGCCGCCATCGCGTTTCAGGAGGTCCTTTAGCTCGCGCCGGTACT
GCGTTGTCACCGCCTCAAAGTCCTCGGCGCCCGCATCGTCGCCAGAGAAGAAGGACACGTCTTTCGCCTCCCCGCAGCCCAGGAGCACCGTCGTGCTCGA
GAGCTCGTCGCGCAGGCAAAAAGCCGCGCCATTCCCAAGCCTCTCCACTGAAAAGCTCATGGTTTTGTTGTACTATGAGAGGGGGCGAATGACCAGATCA
GAATCTGATAGAGTCTGAGGAATCTGAGTATGTTTTTGTGGGTGTCCTTGTAGACTCAAATTGGTCCTCCGTGACCCGTACAACATTTTTTCAGTCTAAC
CATGTATGCGTATCTATCCCTTGTGGTCCTTCGAGCCTGTACAAGCAGCAAGTGGATGCTACGTCCTGCATCTAGAACTTGCCAGCTTGAATAAGTCCGT
CAAAATAAGCTGGCAGTTTGTCCAGTGGCAGGAACGTTTTCTCCATCGTTGCTCGTGTCTGTACCTCAACGAGGCCTTCCTTCACGAAGCGCTTGCCAAC
TACGACACGATACGGGTACCCGATAAGCTCGGACTCGGCAAGCTTAGAACCCGGGCTTTCACGCCAGCGGTCATCCAGCAACACGTCGTCCCTGACCAGG
CCGGTCACCTTGCCAGAAGCTAGTTGGTCAGCGATATCCCATGCAGCCTGGGACACGGGGTCTTCCTGCTTCTTCCCACCGATGGACATGACGAGGATCT
TGAACGGAGCGATCTCGGTGGGCCACGCGATGCCGCGGTCATCGTGGGAGGCCTCCACTGCTGCGGCCACAAGCCGGCTAACACCAAGGCCGTAGCAACC
CATCTCTAGCGGGTGCTTCTTGTTCTTGGCGTCTGTGTACGTCGCTCCGAATGGTTTCGAGTACTTTTGGCCCAGGTAGAAAACGTGGCCTACCTCGATA
CCGCGCTTGTCCTCGAGCACTGCAGCGTCGCCGCCATTGCAGCGCGGGCAGTGGTCACCCGCCTGAGCCAAGCGAAATTGGCCCCACACAGCGTGGGTAC
GCGTCTGTTGCTGTGGCAGGGCCTCGACAGCCGCACAAAGAGCTTTCACGGCACGGGTAGCGTGCTCATTATGCTTCAGTGAATCATCCAGAAGCACATG
CAGCTCCACAGAGGGAAAATGCCCGCCCAGTAGCTCAGCGATCTTCCTTGTGTCCTTGATCACTTCGCCTTCGTCACCACCAATAAACGGCTTGATTGCA
AGCTCATTTACCTCCCTGTCGTGTCGAGCAAAGCAAAGAGCCCACCGGGGAAGAGACTTATCTTCCTCCTCGTCGTCGAAAGCCTCAGAGTCACAGCTCT
CCACCTGCTCCTGAACCAGCTTAACCGAAAACCCGTGGTCCTCTGCTGCCTCCTGAAGGTCCATCACAGTCTTCCAGACCTTCTCGTCTCCAGTTCGAGC
CTGTTCCTCGAGCTGCGCAATGATGGCGCCAAGCTCTGTCGAGATCCCGCCATTTACCGTCTGCTCCGAAGATGGCAAAAGCCCCTGCGCTTTCTCCACA
TTCGCCGCATAGTCACACTCTGCCGACGAACACGACAGAATCGCGTCTTCGCCGATATCAGCCAGCACGTGGAACTCGTGTGAGAGATTGCCACCGATAT
TCCCCGAGTCGGCCTCCACGCGCTTGACCGGCAGCTTGAGTCTCGAGACCAAGATCTGGTTGTACGCCGCAGTGACGTCCTGGTACGTCTGCAACGCACC
GTCGTACGAGGCGTCAAAGGAGTACATGTCCTTCATCACAAACTCTCTCGCTCTCAACAGACCAAATCTCGGTCGAATTTCGTCGCGAAACTTGCGGCCG
ATCTGGTACAGTCGGAGCGACGCGTCTACAGCGCCCGCAGCTGAGTAATGCGCTGCCACGAGGCTCGTGACGCTCTCCTCGTGAGTGGGTCCGAGCACCA
ACACGTCTTCTCGGCGGTCCTCGAGCGCCATGAGCTCCGGGCCGCGGCTCTGCCAGCGCCCCGACTGCTTCCATAGCTCGTGAGCGTTAGCACAGCCAGG
TCCACGCGGTTGCCACCAATTTTGTGCATCTCGTCATCGATGAGCGCCTCCAGTTTGGCTACAACAAGGCGGCCGAGCGGCAGCAGCGCGAAGAGGCCGT
GGCCGCTTTTGCGCACGAAGCCGCCGCGCACCAGCAGCTGGTGGCTGGGAACCGCTGCGTCTGACGGCGCCTCCTTCTCCGTGGGCGCCCACAACACAGA
ACGCAAGGCGCAGGGGGCGGCGCGTACCGCCTGGGACGACGACAGGCGCCGCTCGGCCGTCGCCAAGGACCTACGGCGAGCAGCCCACATGAGCAGCGAT
TTGAGCCGCAAAAAAGGCAAGTATCTCTGGTGTGTGGCGTACACCACATTATTTTACGACATGGCTTCGTTTTTCTCTGCAATGGACTCCCTTCAACAAG
TAAAAAATTGGCATGGGATACTGTCGGAAGCCCCGCAAGATGATGAAGGAAGCAAATTTACCCCTGGACAGCGGAGTCGGTCGAGTTCGTCTTGTTCGCT
GCAAATGCTGGGCTGACTCATCAGCTGGGGAGAATAGTTGTTGCTGGTACAGTCGAGCGCCGGAACCTGTCCGACTTGGCCAACCCCGCAGTCGCCTATT
CGTGTTCCGTCACTTGTCGTCGCCACGTCCGTTTGCACGCAGTGTCGGGCTCTCGTCATGTGCGGCGTCGACACTCGCACGGTTTCAGGGCGTTATTGCC
AACAAGTCCATTGCCGAGGACAGGTTGCACTCAGGATAGGTACACTTGCCCCACAGCAACAGCTCCAACTCGCACGCAACGCATCCAAAGTCCAACGCAA
GAGAAAAAGTGTAGGCTGGATATTGTGGTCCGTAATATCATGTGCATCTCCGCATACACCGCCACATCCGACCCCGTCTCCGTCCCATAATACCCTATGC
CAATTAAACCGGCTGGCGACCTTGACGTTGTCCGAAAAATACAAGCAGGTGCCAAGTCCCAGTTTAGTTTCTGCCGCCTCGATCGATGGCTTCAGCTTGG
CGCCAGCATCCGCACGATCCGTGGGACCTGCCGTCGCCGCCGCCGCTACTAGAAGAAGCCGCGCCCAAAGCTTCCAAGCGCTCACACTTTTCACGCCGCA
GCACGCGCGCCCAGAGCCAAGCGAGAGCCCAAGCGCAGCAGGCGGAGCTCGAGGTGGAGGCGCTCGCCGACCAGCGCGACCGACGAGCGCCGCAGCCTCC
TGGCCGCCATGTTCGGTGGTCGCAGCAAGTCACGCACGTCGCGATCGTCCTCGGACGCCCCGCAGACGCTCGTGCAGCGAGAAAAGGCCTTCCGCCTCGT
GCGCCACGGCTCGGACCCGCTGCTGAACGACGCGTTCTACGCCACGCAGGTGCAGGTAGGCAACTTCGTCAAGATGGGCTGGCTCACCAAGCAGGGCCAC
ATGTGGAAGAGCTGGAAGACGCGCTTTTTTGTGCTCTTCTCGGACGGAACGTTCGCCTACTACAAGAACAAGGGCCGCAAGAAAATCAAGGGCTGCATGC
AGCTCAATGACGGCGTCGTGTCCGTGCAACACGTGGACGTCCGCGTGGCGGACAAGGCCTACGTATTCCAGATAGAGAAGGGGTTTTACAAGCTGCTGTG
TTATTGCTGCAGCCAGTTTGAGGCCGAGCTGTGGGTCGCAGCGCTGCGCTCGGTGCGGAGAGTGACCCCGCCCTGTTACGAGACGGATCTAACGGCCACT
GAGGAGAAGGCGGGCTCCAACGCGGTCACGAGACACTTGAACAAGATTTTCATCACAGATAAGCAGATCGCCAAGAGTTTGGTGCAGTTCAAGGTGAACG
AGCACGACCATTCGTACGCAGCAATTCACAATTTTATTGTCGAGCTGGACGACGCGATCATTGATGGTCATCATTTGGAGCTCTATCAGGACCCAGAGAT
TGAGCTGCTGCCTGGTAATGACCTGGTACGGCTGATTCGTCGACATGTGGAAGATCGAGTGTTTATTCCGTTGTATGCGGAGGCGTACGCGAGCTTGGAG
ACGGACAAGGTCAAGACGAGGCGCAGCAACCTCGAGCAGAACCTCAAGGTGCTGAGGCGGAAAACTCAGGCAGATTTTGGCATCTCGAAGGATTTATCCG
TTTGCGACTGGAAGCTAGCCATCAATGTGATTAACATGCTCGAATGCGTGTCGCTCCCAACGCACAAGTTCGAGGTCATTTTATCAGCTGGAAAGGCCAT
CACGGAGTCTATTGCTCAATATAACGGCGACCTGTTCGAGGTATCAGATGAGACGCTGACGGCGGTTTTTCGGTACGTAGTTACAATGCGTCACTGAGCG
ATTTACCGATTCTGCGAGCGCTTCTCAAGTACGGATACCAGCACCACCCAGCGTGTCAGAACAAAGCAAACGTCGTTTCAGCTTTCCTCGATGGGATCAA
ATGGGTGGAGTGCTTCGAGACTGGCGATGAAAGCTATCAGTTTGATTCCTTAGCGCTAGCAGGGTCTCGCGTGTCGGTATCCATCTCGACTAACGATGTC
GGCATTCAGTTTACGACCGATGGCAATGGTAGAGGGGCTATTGTTTACAGTGTGCGAAAGCAATCACAAGCAGCACTTAGCGCTTCAATCGTCCCTGGAT
TGTCGCTGATTGCCATCAACCACGAACCAGTTATCGGGATGCCTTTCGACAAGATTATCCAGCGCGTGCGAACTGCGGCACTCCCTAAGCAACTCATTTT
CATGACCGAGTTTTACTACTACCAGCTTCTTTCGCTGGATTCGGAGATGTTTCGATACCTAATGTGTATTGCAGCGCGCCGTGGGGACTTGGATTCGGCT
GCTTGGCTGCGGTCGTCCACGGTGGAGCTCAATAAACTTTGCTCGTGGGAAAAATCTCGAGGAAAACAGGTCTTTGGATTCATCCCTGTATCTGGGAAGG
GATCCCCACTTCACGCGGCAGTGCATAACGGTCAACTCTCTATGGTGAAGTATCTTATCTCAAGAGGGGCTGATACGAACTTGTGCAATCAGAAAGGAAG
ACGCCCACTTCATGTCGTGAAGCAGTCGATTGATATGGCGTTGATCATTGAGAGCCTTATTGATGCGGGAGCTGACATTGACGTAGCGGAAAAACACGGT
CTTACCCCGCTAATGTTCATGTGCTTTAGAGCATCGCTTGAAGGTGCCGCGACGCTTGTAGCACTTGGAGCAGATGTTCGCCGTGTTGCATGGTCGAATG
GATTTTCGGCTCTGGAGTTTGCAGTGAAGAGTGAACGAACAGAGCTGGTAGAGTTGTGCCTTTCAAAGGGGGCAAATCCAAATATGCCTACGCTGGACGG
AAACACAAGTTTGCATATGGCAGCCGCTCTCCCCCACGCTGATATAATCCTCCGGCTCCTACAGAGCGGTGCAAACCCCAATGTTCAGAATCGGTATGGT
CAGACTCCGGCCACAGTCCTACTTGCGTCTGCTCCTGGTGGAGGTGGCGATGCCCGAATCCTGTGTCTGGAGATTTTAACATGTGCCGGTTGCCGGTTGG
ACAAACGTGATCTCTTTGGTCGCCAGGCTTCTCACCTGGCAAACATCTCGCGAGATTCTCATGTCATGGGTCTACTTCGAAAGTTGGGATCGCTGAACCG
AGCAGGCAATAGCGTTGATGTCGATATCTTCGGTTGCTCATCTGTTGATTATAGTCATGGGATCGAGGTAAGCAAGGCGACAGAATATTTTGGATCGCAA
ATGCCGAACAATTCGTGGGAAATCATGACAAGACCGACCACGTGTCTCGATCTGCACTCTCGGGTTCTGTCGAGGATTTGATTCGCAAGTTAGTTGCAGG
CACGGAAGTGGACTTGGTGGATGTGGTGGCGTTCGTGCTCTTCTTGGACAGCTTCTCGAGTCTTAACGAATTGGTGGATCGGTTGAGCGAGCATGTCCGA
AACGGGATTAAAAGTAAGTTTTGTGCGTGCTTGTTTGTTAATCCTTCGCGCGGTCGATATGCACCTACATTAGACACTAACGTGGCATTTACCCATTTGT
ATTGTTCGTATAGGCCACGGACTTATCCGTCTCTTCATTATGATCCTGCTTTTTAGAAATACGGAAACGAAGGAAGTAGATGATCTGTCTGATCGCTTCT
ACAGCCTGATCAGTCACAACATTGACGTCCCTAGGGAAAAGTTGGTACCTCTTGTTGATGAGTATACCTCCCTTTATAGGGAATATTTCTCATTGCGAGG
AGCTGGAAACTACGCCACAAATTACGAAAGGATTCCAGAAATGATGACTAAGATATACGGCTTGGAGTCAGGCATTGAGTTCGTATCCGACGAGCCCTTT
CCGCTTCATTTGCACCGGTAAGTCGAGTGATAGCTCATTGTCTCCCTTTTGATCGAACATATCTGACCTATGGATTTCGGTCCTCTTTCGTTGGGTAATA
TCTCAGGTATATTGATGCAGAACGGTGGGCTGAACAGTGCACGCTTCTGACGCACGCAGTCTTTTGCCAGATTCCAGGTGGGATGTTATCGTCTGCTTGT
TTAGTTGGAGGGTTGACTAAACTTTGCTGTCTCTAAAATGCAGTCCAAGATTTGATTTTGACAGGCTCGAAAAAGCAGCACTCCGTTGAATTTACGAGTA
TCAAACGATGGTTTCAGCACGTACGTTCTGTTGTCGCTTTATATTTACGTGCTAAAGAGATTAACTTTCGGGCGTTTTTGTGCGTGGTAATATTGTGTAG
ATCTCTGCGTACGTGATCAACGCTGTTCTTGTACAAAACTCCCCAGAAGAGCGTGCCGAAGTAATTTCGTTTTATCTCAAGGTAAAAGGATATTTCGGCT
CGTTTGACCTCTGGTGGGCTGCATGCTAACCTTTGATTTCGAACTATGATCAGGCCGCCGATTATTGCGTGTCATTACACAATCATGATACGCTGGCTTC
GATCTTATACGCATTGCAATCTACTGCGGTACAACGGCTTAGAAAGTCGATCGATTGTGTACGTTATTACCAGCTATGTTCCTCTCGTGGGCACGAAGTC
ACGAATTCTGATTTGGTGGTGCATTACAGCTAAGTGCGGAAGCGAAGAAGATGATGAACGAAATGCAGCTACTTTCCGACAAAGGATGTCGCGAGATGAA
CCGGTTGATGCGCAAAACTGTCAACCCCAGTATGCCTTATATTGGGTTGTATCTCCAGGTAAAGACGCGCATTTCAAAGTGATGCCTTCGGACGAAAATG
TCTGACATTGTGCGTGTTGATTTAGGGCTTCGTCGGACTGAACGAGTTGCCTGCGTTTGGCAAAGAGGGTCAAGTCAATGCGAGTCGGCTACGAAAAATG
GGCGAGTTGGCAATGGAAATCTTGCACCGCCAGTCTGTTGCGTACACTCTTCAAAACGACGAGAGTATTGATGTGAGTAGCAATTTTGCCTGTCGTCGTA
ATCCTCAGCTGTGGATATCACGTCTAACCTGCGTATGTAACTCTTTTGCAGAAACTGTTGCACGTTTCAATGCCGTATTCGTCGGAGGAGAGTCGATATG
CTCGGTCATTGGAGGTCGAGCCGCGTGAAGCAGATGCGATTCCATTGAGCGATCGCGGTTCGTGTGTTGTTGTTGATGACGACCTCGACCTTGAAAATGA
AGTTCGCGAGTCAGTTGGCGGCGATGGAACCTTTGGATTCCGCCAGTGGATTAGGAAGCAGCAAGTCGTGCACCGCAATCGCTCACGCTCTTCGCTGATA
GCTTTGTACGAGTGGGTGTAGCTGTGATGTGCTGTCTTCTGCGCCGTGCTTTGGTGAATACTTTTATCTATTCGTTGTGGAATGTTTTCGCCCAACATTA
ATACATTAGCATATTTAGTTATCAGCGATGTACTTCTCGAAGTCTTCCATCGACATCATGGCGTCCGGATCCAGCGATAGTTCAGCGGGGTCCTTTTATC
AGCAAATGGCGCTCATTAAGTTAACCACTTGTGCGCAGTTGTCATCCACATGACCAACGTACCTGCTTGTCCTTGTCCTGCTTGTGCTCGTCAGCACCGA
AAAGATCGTTTTGCGACTTTAACACTGGTGACGGCGGATCATCCGTCGTCAGGTCTTCCATCTGCTGCATGATTTGATCTCCCTTTTCCCCAAGCATGTA
GTCATCTCTTCAGACGCGAACATCACCATGTTAGTGCCGCTGTTCAATGTCGCTTCTTGTATGCCTCGACGTACAGGAGGCGATTCAGCTGGATATCGCT
GGCTGCAGGAACGGTACCATCCGACTCGGGTTGAGACTTCTAATAGTACGACAATCTCCACAAACTAAGGCCAAAGTACCAATGCTCGTCAATTGTAGCT
AATATTGCTGCCCACCTCCGTCTTGGAGAAGAGGTCGTGTGGCTCTCGGCGCATCTGCGGACGCTTCGTCTTGCTGTCCTTTGTAATATTCTGCCAGTGG
TGGATCTTGGTCACAATGTCTCTGACGACACATTCTCCGTCAATGCAATTAGCACTTGCGAGAGTGATAAACTGCGTCGCCTACTCGTCTTCCTCTTCGT
CGGCGAAGAATCCACCTCCGTTGTGGGAATTCGCTTGGTCCCCACAGCGCGCCACCTTCTTTGATTCGTTCGCAGGGGCAACGTAGCCATCCGTATGCGC
CGCATCAAAAAAGGAAAATGCTACGATGAAGGCACGTAAATTCACAATAAAATAGTTTGGTCATCTTGTCAGTGCAAGCATTTCGACGCCCTTACTAAAT
CTCGTCTTGTGCTCCGCCATCTTCGTGGTCAAAGCTTCTGGAAAAGATCCAATTGTAGAGTGGTACACGGTACCGGTGTTGAAGCTTGAGCACGGTAACT
TCGAACTTACTTGCGCGCCGAGCACTGCCCATGGAGGTCTATCCACTGGGTAGACCTCTATATAGCCAAGTAGACTTTACTGTCATGCAGAAGTACGCTA
AAGTGTAGCGGCTAAACTAATGAGAGCTAGCGTTGGTGAGCGATTGGATGCTCGTGGAAGGGTTGGAACAAAATGTCGGCTGGATTACAACGTGTACAAT
AGATTACAGGCCGCGCACATCCAACACGCCTCTCTTGAATCGCCCCTTGGTAGCCTGCACGCCATAGTCGACCTTCTTTCGCTTTTGGTGGTCTCTCGAG
TCGCCGCTCGATTTCCGCTTCCCTGTCACCACGTCCGACTCCTTCAACTGAGTGGTCGTACAGCGAAAGCAACAGCAATAGTAGCAAGAGTGAACATGCT
ACAACCGACAACAATCACAAAACACCTCAACCACAAGACGTACCAGCTCCTCGCGACGTTGCTTGCGAGCCACGCCCTTCGTCTTCAATCCGATAAGCAC
CTTGTAGGGCACGCTGCGGTTCTTCGCCGCTTTGCCACCCAATGCCTCGATTTTCTTGGCCTCGTGCGCCTTCTTCTCTTTTCCCTTTAAGCTTGAGCTG
GCTGCCACCGTCAACGCCAGGCACCAAAATCGAAATTCCGTAAGTGGCTCTAATCCCATTGTTCTAAGCTCTGAAAGCTGCAAGACAGTAACGCACCGAA
CTCCAGCACCAAGTCGAACGTGTCATCGAACTCCTTGCGGATCTCCTGGCGCAATGACAACTCAGGTTCCTCTTCTTTGGCTTTGCTCTGCGGCAAAGGA
GAGTGTCAAAGTCGAATCCATATCGAAACAACCGATTCAAGCACGAACCTTGTTCACGCGGGGCTTGCGCTCCTTCCACGTCTCGGTGGGGCACTCGAAC
ACCTGCACTTTCTTCTTCTTACCGCTCGCCACGGGGAACTGGAACGCCATCTTCGACTCTGGTGATGGTCGACGCCAACCAAATGCTAGCGCTAAACTAT
GCTATAAATGTGGACCACATAAACATCAAACCGTGACGCGCGCAACAGATCGATACTATTTTGCTCGAGAAATGCACTATTGTTACTACAGGTTCGTCGC
TACAGTTCAGACCAGAACTTGCACCTGGAACAGACCACTGCTGGCTGCTACACGCTCGTCGCCGTTATGACTGTCCAGCTCGTCCAACTCGTCTTCAGCG
TCACTTTCACCTCCTTCGCCGTAGAAGCTGCTTCCGAGGTCCGAGCCAAAACTGTCCCGTCCGCTGACCGATTCACTCGCGAACGAATCCACCTTGTTAT
CGCTCTTTGTTTCCTGCTCAAAGTCATAGAAGCCGCGGCTTTTGATGACGCGGCTGCTTCGTAGAGGATTCGCACGGCGGTTGTCGTTATCACCACGTCT
GTCCGCTGCGGTCGGAGAGGCAGTAGCGCGCGGTGCTGGTCCGTTATTGTTTTGATTTTGCGACTTAGGGCTCAAGGGAACGAAGACGCTTTCACCAACC
AAAGACTGGTTTAGCACACTTTCGTCGCACGCTGGGACTGCAGGAATCGGCCGATATCGGGACAATCGCTGAAAGCGAGGAGACTCCATAGCATTGACTG
TCATACGTTTGTCCGGTGTTGGCGCTGAAAAGTCGGCCATGGACATCGGACTTGGTGGCTTTCTTCGTCGCCCTTGCACTGCGGGGTGAGCTTGGTCGTC
CTGAATATTCAATTCTCCTAGGGTCTCGCGAAGCTGATTCAACCGTGAGAACGTCTGCGCTTCGGGAACATCGGCTGACCGATCCGGAAGTGCAATACCA
CCACGCGCAATATTCGATTCAAATCCGACAGACTGAACTGGTGCCAGTCGATGCTGATACGAAACAGCCTGGTACTGATCCTGTTGCTGAGCTTGCTGCA
GGGTTTGTCGAGCCTGCTGGGTCTGGAGGTCCGTGTGGTGTTGCTCGTTAAGGGCTCGTTGTGCATCAACAAGACTAGCCATTTTCTCGTTCTCAAGTTG
CAGCAACGCCCGTTGCACACGCAGTTCTTCTTTCTCGCGTCGAACCTCATCCCGTTCTCTCCGCAGCTCCTCTCGTTCACGGCGAATTTCTACCAGCAGC
GAGCGGTACTCATCAATCATACGGCTCTGCTGCTCCAGTTGCTGGCGTGACTCCTGAGCGTCGTTCTCTTGAGGATATAAATGTCTCCCTACTATGCCAT
TGGCCGGGCTTCGATCAAAGGTGTCGCGTCCGCCATCATTCGCACTACTCCGCTCGATACCTAGTTGCATCTGAATCCGCGAAGGAGCAGGAGGAGGCAG
CAGTGTTTCTGCAGGGCCCGTGCTCCCATAATGACGGTCTCTCTGATAATAAACCGCCTTGTCTTCTTCCCGTGGGTCTCTGTCGAATGCAAAATTGTGA
CGACTGCTTGCAGTCGGTTGAAAGTCGTTCCTCTGTCGATCCGTCAGATCTGGCGGTGGCGGCAGCGTCTGAGGGTACGGAGAGTTCATCTCTGCCCTAT
TGTCGTTCAGCTGAGCATTCACCACCGGTGAGAAATGCCCCAGTTTCCGCTGCGCTCGCAGCTGCTGCTCTCGGAGGAAGCGCATCTCTTCCCTCGCCGC
GTCCTCCTCGCCGCGTCGCCGCTCCGCCTGCTGCAACTCCTTCAGCCGCGCCTTCTCCTGCACCTGTTCATCCAGCATCCTCTTCCACTGCATCTGCTGT
GCGCGTTCTCGCAGCCTCTGACTGGTCTCGCTCTCGTCTGTCACTCGGAAGCGCGGGTGGGACGACGAAACGCTGTTGGCTTCCCCCGTCGCGGCACCGC
GGTCTTGTCGTTGCTCGTCGTGCAGTTCCACGCTCTGCTCGAACTTCCAGGGCGACTGGGAGGCCGCTGGCAGCTCGAAATGGCCGCCTTCGACCAGCCA
CTTGGCCGGCGAACGCTCGCTCGGCGCCAGCTTGCGCTCCAGCTCCTCGCGCTCCATCTGCTCCTGGTGCTGGCGTGCGCGACGCAGCGCGATCTGGTGG
TCCAGCTCCCGCGCGTAGGCCTCTCTTCGGCGCTGGATCTCGCGCGGGTCCTCGTCGTTGGCGCCCGAGTCCGCAGACCACATGAGGGCTCAGATTCCTC
CGGCAGAAATTGTCGAACGTTTTGGTTTGAAGCAGTTTTTGAGAGGGAAGGCGTTTGATTGGAGGATAATAGAAATTTGGACTGGTACAGCAACCTGACC
AGGAACGGACCTTCCTAGAAGTTCAACGAGTTGCCAAACAGACACGAGTCGGCGTACTCGCGTCGCAGATCGACCATTAGCTTTTCCACTTGCAAGTCGC
TGCGTTGACACTCAGATTGCAGCAGTTGGAAGCGAAGTGACACGTCACTCTGGAAGCGACGCAGCCTCTTGCGCTCCTTCTTGGCCCCATCTCGTCGAGG
TCGGCGGTGGTGACTGCCGCTCCGACGTCGGTGCTGTTTGTGGCTGCTGCAGTCGCTTTCGCTGCTGCTGCCGCCCACGTCGCTGTCATAGTCCTCACTC
TCAGCTTGAGGCCCGCGCAGCATCTTCTGGATACGGACGCGCTCTTTTCTGCGGCGTTCGCACTGGTCCAGATTGCGTAGCAGCGCATCATGTTCTCGCT
GCAAGCTGTCGAGTCGGTCCTGGCCGCGCTGGAACGTCTGCTCTTCTCTGCTGAGCCACTGCTTCTTGCGCTCCACCTCCCCATACAGTTCCGTCAGTAT
CTCGTGGACTTCCGCGTCGTCGGTGCCACGCGTGTTTTCGCTCTGCGTCAAGTACAGCGTCTTGTGCTGGGAACTGCCATTGCTTGTCCCTCGACCGCTC
GATATTTGCTCCTGTGTGCGCACTCGGAACACGACAGATTTCTCTGTGGTGCGCACGACACTACGGCGGGAACATCGCTGGCTACTTTGCGTGGGAGACC
AAGCGGGGGAAGCACTGCGGCCCCGGGAGTGAGTGCTGGACGACGAGCTCGCGGTGCCGCTCATTGATCGTTGCGGTCCAAGATTTGAGTGACGAAGTGA
AAATCTCTGTTGAAACCCTTGAACAATTAATAATTTCGCTAAGTGAACATTAGTGAATTTGTATCGGGAACAAATTCTCAAATCAGGTAGCCTTCTGAAA
ACAGATATGAAGCAATGTATCGACTTTGTCAAAATTGCAGCTTTTTGCTGTGCATCGAATTGATTGTCTAGCTGTTGCAAGGCCGTTCCTGTCTAAGCTT
CTTGTGCTGCGAGTAGCGATCTTTGCTGGTCACTGCATAGTCCTCGATGAAGCAACACATTTATAGTTCGCTGTGAGGGACGGGTTTGCTGGTGGGGATC
GGCGAGATCATGGGCGAAAAGATGGGGCGAGAAGTGTGCATCAGCGCCGTCGAGTGCGCCCCGCCTGCGGAGACCTGGCGGACAGGGATCGGACCAAGGT
CTAGACGCGTAGGCACGGCGAGCGGCTTCATATCCGTCAAACCCAGTCGTCCGTGGCTGCAAGAGTCAAGAAAAACAGGGCGAGATTAGCGTTTCCTCCT
TGTCAAGCCAACTCGGCTGAACAACGTACTCGGGTCGTCCCGCGACGTAGGCAATGCCGTCGCTCGTGACGAACAGAGTGTGAGAGCCACCACATGCAGC
TTGAATCACCGTTTTGCCCTTCAACGCCTTCACCTGTTGAGGTAGAAACATCGAGACGTCAACAATGATTGCAATACTCAAGCAACCAGCGCTCCGTACC
AAGTGAGGTCGCGTTCGACTCTTTGTGTCGCCAAGACCGAGTCGGCCATACTCGCCACGCCCGAAAGCATAGCAGTCTCCCGACTTGGCCACCACCGTAG
TGTGCCAACCACCACATGACACACGCCTGTACAGTCCCGAAGAACACAACAATCGTTAGCATATTAAAATCCGCACATAGGTAAGCGACAAGACAAGCAG
CTTACAGTGCCGGAATGGCATCGAAAAACTCGACTCGTTTGGGCGTCTGCTGATCGGACGTCTGGCCAACGCCAAGCATCCCGTAGTCCTCTTTTCCCCA
AATGTACACGTGCCCTTCCTCGGTCACAGCAGCCGAGTGGAAAGCACCGCAAGCGACTTGCACGACCTTCTCGCCGTTAAAACCTTCAAGCAATCGTGGT
CGGCTGACTCCCAGAAGTCCCTCGTCCTCCGTGTCCTTCAGCCACGCAGCCCCGATGCCCAGTTGGCCGCTATCACCTCGACCCCAGACGTAGACGCGCC
CCAAGCTGGTCAACGCAGCCGTGTGCGTCCCGCCGCAGCTGATTTTTAGGATCTTTTCGTTTGCATTGCCTTCCGGCATCGGGCACTTGACCGGCAGCGA
CTCGTGCGCCGCCTCGAACTCCTTGGGCAGACCCAACTGTCCCCAATGCGACTCGCCCCACATGTACAGCGTCCCGTCATTGGTCACAGCAGCAGAGTGG
CAGCCTCCACACGAGATATAATCCACCACGAGTCCATCCAGCTCAAAGAAAGCGATCTTCTGCGGCTCATTAATACTCTTGAGGTCTCCGTGGCCCAGTT
GACCCATCTGCACAAAGCACAAAGCGCATCCAGTGAGTACGTCGAGCAATGCGCGCAAGAGGTGGCGGGGAGCGCACCGATCCCCATCCCCACGAATACA
CAGTGCCGGCAGCCGTGAGCGCCATCGTGTGGCGGGAGCCGCAAGAGACCGCGATGATCTCCTCGCCCGCCAGACCGTCAAGCTGGTTGGGGAAGTTGGA
GGCCGACACGTCGTCGAGCGCCAGCGTCGGTCGGCGCTTGGCACCCGTGCCCAGCTGCCCGTCGTCGTTACAGCCGAACGCTATCACCGCGCATTGCGTG
GCGCCCGTCGAGATGCTCATCGTCTTGATGCTGGTTGGCAGTCTTGTTGAATGCAAAATTGAATGCAAATGCCAGCGAAAACCTGTTCAGATCGATTTGT
ATTGTTGTATTTGTTTGTATAAGTCGTATTTGTACCTAAAGATGAATACATAACACAAAACGTACATGTAACTTCAACATTGACGATCGTCCACGGGGAC
CTGTGTGGACGCTTCCGTTATAGGAGCGTACATCTGCGCCTTGAGAATGTGGACTCGAGGGCCGCGAAGTCGACCGCGCTTGCCCTCGAGCTGGCGCTTG
ATCTGCGCGAAGCGAATAGCGTTCGGGTTCCGAGGCGGCATGGTACCGCTCCACGCCTTGGACTCGCCAGTACTTCTATCGTTGCTACTGCTACTTTTGA
GTGAGTGCTGGATATGCGAGTGAGTTTCCGGTCCCAAGGCGCCTTCGTCGTCCTCGTCGATAGAGTTGATTCCGTATTTCTTGGCTGTGTTGGTGAGCGA
CGGCACGAGCATGCGCGTGGTGCGGTTGATCTGGAATTGCTGCTTGTACTTAGCCATCAGGCGTTGACGGAAGGCTAAGGCCTTCGCCTGTTGCTCACGC
GCCGCCATTTCTCGGCGGTAAGCTTCACGTTGAGTCGGGTACTTGGTGCTCACCTGCAACGCTCGACAACGACGGCGACTTGCATCGCCACGCACTAACC
GTTGAATCTTCACAGCTGGAGACTGCCGAATACTTTTCAACCATCCTTTCTGCCGCTTGTACTCGCGAAATACCACGCGCGTGGTTAGTCCTCGCCAGTG
CGCCTGGATACGGCTGACCAGGGCATGCTCGCGACGCAGAACGCGCCTCGTGATTTCCAGCACGTTGTTCTCCACCTTTATCAGTGTCGGCCTGCCACCT
GATCGACGCACATATTCTCTGTAGTTCCAGTAAAAGACGCTAAGCTCTGCTGTGTTCGTGTACCAGAAGACCGGTGGCTCGTTGGGTCGACTCGCTAAAG
CGTAACTAAGTATCTGCGGTGCCATGAAGCTGATTATCCGTAGACACCGCTCGATCACCGTTCGTCTCCGCGCCTGCATCCCCCGTACCCGGGTTTGAAT
CCTTGTGGCCGCTCGATTGATCTTCCGCAGATATCGATCACGCGCTACCAGGCGACGACGGAATTCCAGGCGTCCCAGAAATCCCCTCGCGATACGCTGG
AGCAGTGCAGTTGCCGGGACACGTCGACGTTCGAACTCCTTGATGGCATTTCGCTCTTCCTCGATCTGTTCCTGGAAGCTCACGACCCCTGCGCGTAGAT
ACCGAGTGCTGCCACACCCTGGGCATTTCGGTACTTCTTCATACAGAAACGTCGTGTCTTCTCTTTCGCCCAACTGGTCTGCCTTGCGCCGTACTCGCAG
CACGTCGATGAACGTCACGCTATTGCATCGTTGGCAGGTCAGGTACGGTGTCATGGTACTGAGCAAGTCGTCATGGCTGAGCTCCGGCTTTTGGTCGAGA
GCATTTTCGACGTTATCAGGAGTCGTGTCGACAGTCGAAGCTGCGTTTGGTGAAGGGATCTCGGCATTAGTCTGAGCGATTGAGTCGCTGCTCACTGTTG
GATGTGGGTTGCCTGGTTGTGAAGAGTTGGGCATGGTCCTCGAGCTGCCAGCGAGCCATGGAGTCGGGTCACACTTGTGCACCCCTTCGCTAACCGATTT
TCACGACTGGATACCAGTGGGTGCAACTGAAAATACTAAGCAAGAGTGGTTCGTGTTTCATGTGCTAAACGCAAGTTGTGCAGCCATCCAACCTTATTCG
TCGTCGGCGATGTCTTCTTCCATTTCGTCCTCAATCTCATCGTCTCCAGGACGCCCCATCTTGTCGTCGCGCGAGTTTGGACGACTCATTTGCGCCTCAC
GAGAACCTGGGCGACTACTGGGAGCCTCACGCGAGGCAGGACGCGATTCTGGGCGACTGGATTTGGCATCACGCGAACCGGGTCGGTTGGACGAAGCAGA
CTGCTTGTAGTCACTGGGCGAGGGTCTGCGGCGTCGGTCGTCACCCAGAGAAACGCCTAACTTCGCTTGCACGGACTCCACCACCCGTGGGTCGACGTAA
GTCTTGATTGTGAGCCCCTTACGGTTCATCTCCTCCATCGTCTCAAAGCTCTTGTTCAGCTCGCCTTCTTCGTAGTACGCTTCTGTTAGCATTGCATATG
CGTCGCCCACACGGATAGCCTCCTCAATACCTGGTTCCTCCAGCAGTTTGGTGACAATGTCCATCATCTCTTTCGGGTTGTGCTTCACTTGCTGTCGGGC
GACGACGAATTGCTCGATCAGCAGAATGCGCTTCTCATAACGCTTCAGCAGTGCTTCCTTGCCGTCTGCGCGAGATTTGGACACCACCTGAACGGCTTCT
TGCAACGCAGAAATTGCCTTCTCGTAGTCGCGATATTCCTCGATTTCCACCTGAGCACAACCGGCATAGAAGGCTGCAAGCTGCTCGAATGCACGTGCTT
TAGTGTAGAACCCCATGATATTCTTCAGGATTTCCGGGTCCTTGCGCCAATCCAAATTCTGCAAGTAGTTCGCAGCCAGAACGAAGATTTGGGCGTTGCG
CGATACGTTAGCAAAGAACACGACCTTCTCAGTGTCGCCGGACTTGAGCAGACATTTCATGGCCTTAAGCTTGTTGCCGGCTTGAGTGTACTTCTTCGTG
GCCAAGTGATACGAGCCTTGCTGCTTGCAGCACTTGGCAAGCTTAAGCAGTAGCTCAGTGCGCTTCTTCTTGTCAGCCGGCGACGCGGTGTCATCACCTT
TGGGAGGCGTCATCTTCTCCGCCATCTCTTCAGTAACCTTCACATCGTGTTGCATGCACACATCCAGAGCCTCTGCAACGCGATGTCCGATCAAGCACAA
GTGCACGGCCTTAGCGAAATGACCGTTTGCGATGAAGAAATCAGCGCATTTTTTCAAGATAGCGGGCGAAGTGTTGCCAGAGCCACTGAGTTCGTCCGTG
AGGTGATGCAGCTCCTCAAAGAGTTGGGCCTGGAAACACAAATCGAGGGCCCTAGCCACGTTTCCTCCTTTGTGGTACAGCTGGACGGCTTTCTCCATTT
CATGTTGCTCTTCGAAGTATGCAGCACAATCAAGCATATCACTGGGCTTGCTCATGAGCGCGAAGCCCATGAGGTCGGCGTCCATGCGGTGCTCCTTGGC
CAGACGAATGGCATGGTTGTAGCAACCACCGCTTGCGAAGAAATGGATAGCGTTGGAAATTTCGTTGTGCGCCTCGAATTGCCGGGCCAGATGATACGCT
GCTGCGCGATTCCCGCTCGTCTGTGCTACTTTCGCAGCCGTCTGGAAGTCTTTCTTGAAACACAAGACGCGTACAATGGACAGGTAGTCCTTGGCACGCT
GATAGCTTTCTACGGCAGCATCAAATTGTCCCTGGCTCTCTTGGAACTGAGCCCACCAAATTAGCAGGTCGCGGTTGTTTGAAGTTGCTACGTACTTCTG
GAGTATGTCCACCTTGCCCAGCTTGAATAGCATGCGAGGAATATCCTTTTGATGAGTGCCAGCATCCTCGTAGGCTTCCATCGCCTCCTTCAGATCTCCC
ATTTCCTCGTAGTGTCGTGCCAGTGCGTGGTAAGTTGTCTTGAGATGAATGCGGTCGCGCTTGGCCGCTACATCAACAGCCTTTTTCCAGTATCCGCTGG
CCTGATAGAGTTTGTTCAGGAGGTCGTAGCGGCCGCACTCACGGTACAAACGGGCTGCATCGTCGCGAAGGCCTAGTTGAATTGCTACCATGGCAATCGC
AACTTCGAGCTCAGGTTCTCTCTTTGCCTCTTGCACTGCAGCCGCACCTCGAGCATGGCCCATATTCCCGAGACATACCTCAGCCACATCCAGCCGCTTC
GTCTTCACGCACATGCGCGCCATGTTCTCCCAGACGGACGGATTTTCAATGAGTTTGACTGAGCGGTACGCTTCATCCATATTACCGACCGTCATGAAGT
AGCAAAAGTCGATTAGAGCTTGCTTCGCCTCATTGTTGACCTTATCCAGCCCCGTGAAGTCGCGCATGATCTGTGTGCGAAGATAGCTAATGGTGTCGTA
AACCATGGGAGTTTTAGTGACGGGGTTGTTAGCCTTGGTCCGGCCAACATGCACTACGGTTGTGGAGTCATCTGATGAGCTGTTGTCCACCTTTGCCACG
AAATATACACGTGGAACTTGAATACCTAGTAGCGCGGAGTACTTCAGATCAAGGTCAAAACTGTCTTGCATCAGTAGGCCGTGCTCGTTTGACGCAAAAA
TGATGGTGACCTCCTTGTCTGAGACTTGGTTCCCGCGCGCACCACCGGGACCACCAGTCCCCAAACCGTCGTCGGTACGACCAGCAGCAGCTCCACCCGA
TGTCGTCGACGCACTATCATTACCTGTCTTGACAGTCTCGCAGATAAGCAACCGTGGCTCTTGAGGATCGAAGAAAGCTGAGGTCGGGTAGCGTGAAGAG
CCAAAGTCAAACTGCTGGTAAATGTTGAGATCCGTTTGAAACAGGAAAAGCTTGTTCAATGGTTCTCGCATTAGCAAAGCACCTTCAACGCGGTCAGCAA
GAATGCAGATGCGAGTGCCGTCCGAGTTGACACAGATTGCTCGCATCACAGCAGACTTGGTCTCTTCTCCAAAAGCTTCGGGGAGATTTCCCATGCTTCC
TAAAGCTTTGGGGTCACGGCGGGATACGTCGAATACGCGCAATAGGCCCCGATCCGTACCCACAGCAAGAAACTTGTTCTGAAGTGACAGCATCGCCGGC
CGGCCTTCGGCTTCCGTGAACGAAATGGTGTTTTTCACTACTCCTGCAAGGTTACAAACCTCGACATGATTTCCGTTTGCCCGATAAATGGATTCACCGC
GAAGCACCATAGCACTCGAAAAACACTTGAACTGATTAGTGACTTTGGCATCTCCATCTTTCATTTCGTACACTTCTGCTTTTGATCCGTTCCAAACAAC
GAGCGTTGATCCGTCGTGGGAAACACCCTTCACACATAGCGATGCTTCAAGTGTCGACTGTGTGATTGTCACACCAGACTGCGCTCCATCTTGGAACTTC
TCGATTGAGAGTGTCTTCGGTCGGATTTGAATGACTGATGTATCTCCACTAAGTGCACGCTGCATGTTGCCCTCATGTAAAATGACCACTCCTTCGACGG
TGTTGGCGTACAACGCAGGGTGGGCATTGCTCCAGCCGATACGTGTGACTGCACGACCCACTTCTGCCGTGAAGAGCAAGTCCCATCGGTACGACACATT
TGCGGAGTCTCCAGTACCTTGCGTCGTGTCAATGAAAGACGTGGCACGCCAAAAGAAAACTGCCCCTTGAGCTGTACCCGCCACGAGAACGCGCCTTCGC
GGGGAAAAACTCAAATTGTTGACGTTGTAATTGAGTCCACTTGACTTTGGTAGACTCAATACACTGTTCTCTTCAGTACGAATGTTCCAGAACCGCACAA
GTGGTTCGCCAGACGCAATTGCTAGTAGCCCCGGACTAGCCCACTTTGTTTCCAGCAGTGAACCTTCTCCCGCTAGACTCAGCTTGACTTTAGTAATTGG
CTTTACTGTGCCGTCCGTGACGCCCACTTGATACACGATAAGCTGCACCGCCCGTGTGATGACAATGAGGCGGCTTTGCTCCTCGAAAAACATCATCGAC
TCAATTGCGTGGTTTAGCACCTGAATGTCCGAAATGTGGCCCAAATCGTCGGCATAGTGTACAGACCCCATCTCACCACCGAAAAAGAACTGTGGACACG
CGTGCTGAGAAAAATGCTCCCTAAGCAACACAAAGACATCAAATCGAGGCAAATTAGCGCAATAGCTAGCAGAACCATTATGGAAAGTAACATATACTCA
CATTTTGGTGTGGCTGTCCTTTGGTGGCGCTGATCGCGTGGCGAAGACACAGTGAGTGAAGCTACCTTGACGCGCATATTGCGTACTGAGGGTTAGCTGG
CACCGACTATCCACCTTCCACACGGCAAATATTCCGTTCTCATCCGCAGACATGAGTCGATTCCCTGACGGGGACCACTTCAACAGACACACGCGGCTCG
TGTGCGGCGAGTTCACTTCGCGCGCCGACTGTTCCTTGAATACCCACAGCGAGACCATACCTGGCCCGCACAAGCCAACAAGACTCAGTGCGCGTTGATA
GTATTAATTCAAAGGCATCCAACATACCGTCGCTCCATCCGACCGCGACAGCTCCGCCACGAGGCTGCCAGGCCATCGAGACGATGTCGGCACTGCGCGA
ATAGCTCTCCAGACCTTGCTGCTTCTCACCCTACATCGAGTAAGGGCCCATGCAACCGGTTAATGCTTCGGATCTATTGGTTACCCACCAAACTATTTGC
TGCCAGTACCTCATCCGTGAAGAAGTGAATCTCTCGGTTCTCCAGCGCCACGGCCAGCACCGGGTCCAGCTCTCCCCAGACCGAGCAGACCTGTCGCAAA
TTCGCCGGCACCTGCACATTGTAGTCGTAAAACAATGCCATCGTGCACTCTCTCGCCTTGCCACCACTAGATCTTCGAGTGCATTGCTCGCGTCGCTTCA
AGATACAATATGCATTTGCATAGGTATGCTTCACATGGTCATTATGTAGTCCACACTACGTGGTGTCTACACACACCACATTTGATCGAAGTTTGACTGG
TTGGGCGGCCACTGGTCGTGAAAGGCTGCGGGGCATTGCTGCATACTCAGGGACTATGGCGGTGCAAGCGAAAACGTCGGAGCCCAAGGGCAAGAGCTTC
ACCAAGGCCAAGAGCTTCACCAAGGGCTTCAGTGGCAAGAAGCGCCCGGCCGGTGGCAATGGCGAGGACGGCAAGAAGTCGTTCATGGACCAGAAGCTGG
CCAAGAAGCAGCGCAAGATGCAGCGCCCGCACTACGAGATGGTGACGCGCGCCAAGCAGATCTGGAACGTCATCCGCGAGCGCGACGTGGAGAAGAGCAA
GCGTGCTACGCTTGTGGACGAGCTGTACACGCTGGTGAAGGGCAAGATCTATGACGTGGCGGCGAAGCACGACGCCTCGCGCGTCATCCAGTCGCTCATG
CAGTACGGCAAGCCCGAGCACCGGTCGCAAATTGTGCTCGAGATGAAGGAGCACCTGATTGAGGTGGCCAAGATGCAGTACGGATGCTTCCTCGTGCAGA
AGATGATCCGCTACGGCAGCGTGTCCGACCGCGCCGCCATCGTCAAGTGCCTCTCAGGCCACGTTGTGCAGGTGGGCACGCACAACATTGCGGCTAATGT
GCTCGAGTATGCACAGGAGTATCTCAAGCCGTCGCACTTACGGCGCTCAAGCTCGAGTTCTACGGGCGCGAGTTCGCCTACTTCCACGAGGAGAGCAAAC
GCAACCTGGCTGACATCATCGCGGCGCACCCAGACAAGAAGGCGGACGTGCTCAAGCATCTGAGCACCATTCTCAACCGCATGGTCGACAAGCAGCTTCT
TGGTTTGGCCTTCGTGCAGTCCCTGCTGTGGGAATATCTGTGCAATGCTGAGCACGACGACGTGATGCAAATGGTGGCGAACGTGCGTGACGCTTCGTTG
GCTCTGCTGGCTACGCGCAACGGTGCTCGTGTAGTGAACAAGTGCCTGTCGCTTGGTGCGGCCAAGGACCGTAAACGCATTATTAAGGCTCTCAAGGACA
AGGTGCTGGAGGCTTGCAACCACCCCAGCGGTTACCTTGTGATCATGCGCATCCTGGATGTCGTTGATGACTCGGTTCTTGTGCAGAAGTCCGTTCTGGC
GGAGATGAACGACGAACTCTTTTCGGTGGCGATGCACCCGAGCGGACGCAAGGTTCTACTCCAGCTGCTCAGCCCGTCGAACAAGAAGTACCTTTCGCCG
GATGATCTTGCCCTGTTGGAGCCTCCCATGCTTCCGTCGCCTGAGGACCCGAAGGTCTTGGTGGTGAACTACAAGAAGGACCCGGACGCTCGTCGCGAGG
AACTCCTGAAGGGTCTCCTGCCCAAACTGGAGGAGATGTGCGTGGAGAATGCCACTGCCCTGATGCGCTCGAAGGAGGGTCGTGACGTGATTGTTGAAGT
TGCGAAGCGAAGTCAGAGCTCTGATCTGGCGGACAGTGTGGCGGCCGCCGCGTTGGCGGAGCCTATCGAGGAGGAGGAGGCGCTTCACACTGATGCTAAT
GGCCACTTTGCTTTGCGTCGTCTGATCAAGGAAACTTCGCTGGCGGAGCCTCTGCTTTCGGCCGTCGAAGGTCAGCTTCCGCAGTGGGCCTCCACCAACC
GGGGTTCTTTCGTGGTTCTTGCTTTCCTAGAGGCTGAGAAAGGACCCAAGAACGCTGCTAAGGTCGTCAAGAAGGCGCTCAAGCCTGCGATGGGAGACTT
GAAGAAGCTCGTCGACCAGCAGAAGGGCACTAAATTACTTGTCGAGAAGCTCCAATAGAGAGGAGATAGCTCAAACTTTATAGATCCACAGGTTTTGTTT
TCGTTGTGCACGCTCGTTTGGGTTTCGGACAATATCTGGACTACATTTAATCCTGGTCGTCGCTATCGTCTTCGCTATCGTCGTCCTCAGATGTATCTGT
AGCGCCACCTTCTTCTTCGTCGCCCTCCTCGTCGCTGTCGTGAAACGCTACAATGGGGTTTCCTTCTCGCCAATTCTTCACCAGCTCCAAAATTTGTGGA
TGCTTGTGCAGAAAAGCGAGGTAAGAGAGCGTTTCTCCAAACTATTCGAGCATTGTCTTGGGTTAGCGGGCATGTTTGATGATAACTTCAAGATTTTGTT
GAGTTTACCTTGTTCGGTTTATCCGCCAGCTCGGCATCGCACTGCTGTAGCATGTTCATCAGTAGATTTACGTTGCCACAGGTGGCCGCGTAGTGCAAAG
CTGTCATGCCTTGGGCCTGTCGTACCACAACGACCGCTTACTCTTAACCATTTCTGCCGAATAATGTTTTCAGAATTTTGCTGTGAGTCCTTGCACGTAC
ATCTTGTAAGGTGAGATCTGAGCCAGCGTGCAGGAATACCATGCCTAGTTGGTGTAGAGGTGTTCCTCCTTCAGCACAGAGCATCAGTGGCGACTGTCCA
AACACCTATGGTAACGCGTGATAAACAATATCCTCTACAGAAGCTTACAATGCAAAGTACCTACGTTTCGTGCATCAACCGAAGCGCCGA