Description :
From Genome Similarity Track
Location :
contig_100:39451- 40557
Transcript NameFunction/comments
g11021.t1hypothetical protein

Sequence
1106 bases(100 bases per row)
GGCTTGTCGACGTCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAGA
TCCTACGTGCTTTAGCACGTACGAGATTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATC
TGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGT
CACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAGAA
GAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTGATGCCACGACCGGTGGTAAGGCCGTCGGGAGGTCCCGAACCAATGGACCTCT
CGAGTGCGACCGCTGCTGGTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTATGCCCGCGAGTGCACAGCA
CCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATAAAAAAACAGGGACCAGCAGGGGCCCCGCGCCTGCTGGTGATGCG
GTCGAGCGTGTCGACATCGGACACGTGCAATGAAGATCGCTGCCCCCAGCGATAGTCAATCTCACTGCAAGAAGCAAGATGACAAGACGAACCTTGTCAT
CCTGAGGTAAGCTCGAAGAAGGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGAGCGCCGAACAACTTTGTTCGACTGCAGAGCTTCCAAGGCTTGACTT
CGATGAAGTGAAAACACTCGAAGTCTATTGGAAGTGAGGCTAGCAACAGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTATGCGTACGCTTCTCATATC
AAGAGAAGGAGTTCGTTGACGAGCTTATCGTCCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCGTGGCTTGCACGGCATGATCCGGTGATC
GACTGG