Description :
From Genome Similarity Track
Location :
Scaffold_93:3945- 8926
Transcript NameFunction/comments
Hyaar_Emoy2809020hypothetical protein

Sequence
4981 bases(100 bases per row)
GAATCACTGAAGCCTGACATCTTTAAATACAAAGCAGCTGAAGAAGATTCTCTGCTGAGATGGTTTGTTGAGCTAGATGACGCCATAAGCGCTCGTCACA
TCGTCGATGAGCAAATGCAGGTCGCATTTGCTCAGTCGAAATTTGCAGGGCGTGCGAAGACTTGAGCCTTGGGCCTCAAGCTACACGACCCATTTGTCTT
TGGGTCGTTAGAAGTTTTCAATTTTCTGCTTAGGAAAACATGCGAACCACCGCGAGATGAGTTCAGGGCGCGCTCTGAACTCCTGAAACTCAAACAAGGC
AAACGTGATGTACACTCGTACTTTCAGTACATACGTCGTCTTACGAGTTGCATCACAATCAATACGCCGAACAAACAAACATTGATTACTTTGTTCATGC
AGGGTCTCACAGACGGTCCAGTCAGGACCTATCTCTTCCGGTTGGAATTTAATACCCTGGAAGAGGCAATCCAAGTTACGGAACAAGAAGATTTCAGCGT
GAAACAAGCATACGTGAGTTCAAACTCTTATCCTCCCTGAGGCGACAGGAAATTAGAGGCCCAGAACCGATGGACCTCTGTTACGCTGAGAATGAAAGCC
CTCGTGTTACCAATTATAATAAATTGCAGACATGCAATAGGTGTCAAAAGCCAGGGCATTATACATATGAATCCAGTGCCCTGGACTCGGTTCCACGTAC
CGCAGGAAACAGTAACCGTCAAGCGGCCAAGAAGGGTCCCAGGCGTGGGTCCGACGCTGTTGCAAAAACGAAACACTGAAACGGACGACCAAAAATCGGT
CAGGGTCGGTAGTTGCGGAGCACCCTACTGATCCAGCAACACCAAGTGAATTTGCAGGCCTTTTGACGAGGATTGCTACCAACACGCAATCATTGTGTGT
TACTGCATTTGGTAGTGAGGTTTCCCTCATTACCTTGAATCTCGAAGTGGCAAAAGACATGTCACTACGAGCCCTAGTCGATTGTGGGGCGTCAAACAAC
TTTGTACGACGCCAATCACTAGACAATAGCAAGATCAAATACATCAAGCGAGAGATCCCTCCAACGAGGGTAAAGATACGCCTCACTACAGGCGCATCCG
TAACAGTGATGAAACGTGTATTAGGAATTTCCTATACACTGAAGGAAGTCCTATACGATGATGACTTCATCGTCTTGGACTTGGATGACAAATTTGATGT
TATCCTTGGTTTACCATGGCTCAGAAGGTAAGAGCCACAAGTCAGCTGGCATCGACGAAGTGTCGATATGCCCGCCGCTTGTTCACCAGAAGCCCATCTG
ATGAACGTCTTGGAGTGTCCACCACCATGTAGATGTACTACGAGTGAGTGCGATGGCCTCACGTGTGGTTCGGTAGTTAGTACGACTGCACAAGATCACA
ATATGACTAACCATCATATTGCTCAAGATTCCGGTGACTGCATAACAATGCAGGAAGCGCCGAAGACCCACCTCTCGAATAAGTCGAGCGGACCGGGGCA
TGGTTGCCTCCTTAATAGACAGCACCCAGATCATGACCAACCGATTGCCAATGATTTTCAATACTGAGATCGAATAGCCCAAAAGGCTAGAGTTGATGGA
TCAAGTCCCCAACAAACAGTGGAAGTAAGTTCCCATAAAATAACAGAGACATTGAATGTCCTGGTTAATGACGGATCAAACATAGGTAGTTAGACACTTG
ATCTGATCGCGCCTCCGAAATTAACTTCGGAGATCACTCAGTTACCCCCGCTGAACCAAAAGAGGTTCTTGCGTGATCTGCGTAGTGGCAAAGTCAAGCA
GATCTACGTACTCGTCGCGGAGGAAGGGTACCTCAGTGATATCCGATCGACAATGGTCTTTGCCGAAGATGAACGAGTTCTCAGTAGCTCGTCAATGTAC
GAGAGTGTCCTTGATGAGAAGACTCAAATTGAGCGATATACATCCCAATCGTGGGAATCGATCAGAACAAATCCTCTCTACGATGATTTAATGGAATTCA
GGGATGTATTCCCATAAGCAGTCCCGTGCGAGTTACCTAAGGACAAAGGTACTCGTCACGAAATCGACCTGAAACCGGGTTCGAAGTACTGTGTCATGAA
GTAATGGCTACTGCATCATGGAAAAGTATTAGCGATCGACAAATTCTTGCAGATCGCTTAGCAGCCCACCATGTGAGGGAGGACACCTCTTCACATCTCT
CTCCGACCTTCTGTGTGCGAAAGGCCACAGGAGGGTGGCGGATAGTACACGCCTTCAACAAGCTGAACGCTGCCACTGTACCGGCCCAAACACCAATACC
AAGGAAAGATGTCATCATAGACGGTATGGCTAAGAGTACCATCCTTTCATCCATGGATCTGAGGGATGGGTTCTATCAGATCCTTATGCGCGAAAGAGAC
ATTCCTTATACTGCAGTGAGCACCCCAAGCAGTATGCTTTGGGAGTGGTTAGTAATGCCACAAGGGATAAGTAATGCCCCTGCCACATTCAACAGATGTG
TAACGAATCTATTAAGATCCGTAAGAGAGTTCGCGCCCAGTTACTTCGATGATCTGTTCGTCCATGGTCGCGCTATGGATGTACAGACGGATATGAAAGT
GCACCGACTCCACGTCCGGAAAGTTCTTACACTAATGCGCGAGCATAATTTGTACGCCAACCTCAAGAAGTGTATATTTGTTGCTAGCGAAATACCACTT
CTTCGTTGCATCGTGGGCAAGCATGGCGTCCGTCCCGATCCAGAAAAGATCGAGGTGATCACCGACTGGCCGGTGCCTACAGATGTCAAGGGACTTCGAA
CGTTCCTTGGACTAGCGGCGTATTTGCATAAATATTCACGCAATTACGCCGAGATGACTGTTCATCTCTCTCGTTGATTAAAAAAGAACGAGGAGTGGGA
ATGGAGTGCTGACTGCCAGCGCTCTTTCGAGGGTATCAAGCAAAGCTTGATACAATCGCCAGTTTTAGCAATTGCAGACCAAGACAGGCCATTCCACGTG
GTCTGTGATGCCAGCGACTTTGCAATCGGCTTTGCATTAATGCATTACGATGAAGACGATGCAGAAGATTCGAAGCGTGTCGTCTGTTACCATTCACGCC
AGCTGCAACCAGCTGAATGCAACTACCCCGTCCATGACAAGGAACCCCTTGACATGAAGTACGCGCTGGCTAAGTATAGAGTCGATCTGCTATATGATAG
ACCCTTCATCGTTTTTACAGACCATGCATCTTTACAAACGCCGTAAACATTCCACATCTCTCGCAGCGAATGTGAGGTGGCTGTCGTTCTTTGAGGAATA
TACCTTCTCCGTAGAGTATAAGCCAGGACGACTTAACGTCGTCGCTGACGCACTCTTGCGCCAGCCCGATTTCGAGCCGGCTGCGCCACCCGACACTGGT
CCGACCACTGTCGCCGTACTGACTTCAAGTGTCCCGTCGTCAACCTTATTGGAAGACATAAGAAAGGCGTATGATCCAGGAATGGTGCGCTTGATGCATC
ATCTTTCGCACCCATCCGGAAAGAGCCTCAAACAGTTGTCGTCAGTATATAGATCCTCTAAGGATAGATATACAGTTCGCAACGTCTTACTTCGATATTA
GGCTGTTGCTGGCGACACACCTCGTGTCGTCGTACCAGATCATGGTGATCTGCGTTTGCGTATCATGTATGAGTACCACGACGCACCTGTTGGTGGACAT
TATGGTCATGAGAAACATATCTCACAGTGAGCCGCGACTTTTACTGGCCCCACCAGTATCAGTTCATGCGCAAGTACGTTCGGGCCTGTGAGGTCTGTCA
ACGGGTGAAATCTAGTCCTTCCCTTCAAGCCCCGTTGCAGCCTCTTCCCGTCCCGGCAGAGTGCTGGGAATCCGTCTCAATGGACTTTGTCTTTGGATCC
CCCACAGACTCTCACAAGAATACTGGTATTCTTGTGTTCGTTGACAGGTTCAGCAAGATGGTACATCTGGGTGCTGTCCCCTAATCAATCAACGCATCGG
CTTGTGCCCGTGTCTTTATCGACACGTCTTTCGCGTTCAGGGGTTGCCTCGTGAACTCGTGTCCGATCGGGACTCGCTTTCACAGCTGAGTCCTTGCGTT
CCGTGTTCAAAACACTCGGAACGCGCTTAAAGATGTCCACGTCTGACCATCCTGAAACAGATGGTCCGACCGACCAAACGCGCCAATCGTGTCCTCGAGG
AGATCCTTCGAGGATACGTTCATTCCTTTTTAAATTGGAGCGAATTCCTGCCGATGATGGAGTTCGCCATCAACAATTCAGTCCATGCGTCGACGACGCA
CACGCCGTTCTTCGTGAATGGCTTACGCCATCTGCGTCTTTCCACCTTTTAAGAGTGTGAATTTCGTTTAAATGGGGGAGGGACTCATCCAAGAGATCAT
CAATCCGACTCTCACTCTTCACGTGCTGACAATGCGGTCACCACGTTCGACGCCGATGTCGATCACATCGGATTTGGTGAAGAAGACAAAAGTAAGAGCG
AAGATGCTCTTACTGGCCACGATACTGGTCAAATCAGCATCACGCCTAGTGCGTCCAAAGACACACTCACGGAGACGAAAAGTGATCTTGCTACAGTACG
CTCCAAGAGCACTGCAGCTAAAGACAGCGAGTCAGCAGATGAATTCATACTGGCTTGCGAAACGGTTGTCCGTTTCGTACAAGACTCTATCGCAGAGGCG
GTCGATCGACAAAAACGAAACGCTGACAAGAATGGAAGGGAAAATGTTCTTTGATTCAATAAAGGAGACTTAGTCCTACTATCTCCGGTAAACCTACCTT
TACACATAGTGACTAACGTGGTAATTAACAAGTTACTACCCAAGTTCATCGGTCCATTTCATGTGCTGCGCCGCCTAGGCAACGCATATACGATTGAACT
GCCACGTAAGATGCGCACGCATCCTACGTTCTACGTCGGTCGCCTTAGGCCGTACTATCAGTATGGGGCTTCTTCCGGTGA