Description :
From Genome Similarity Track
Location :
Scaffold_368:3945- 5270
Transcript NameFunction/comments
Phyke_g10098hypothetical protein PHYSODRAFT_309331

Sequence
1325 bases(100 bases per row)
tcttcttctcaggTACTTTGAGGCGGAAATATGAGCTACGTGAGCTACATAAATGGTCGTCCTTAAAGCGACCATCCTGTTGCGAAGAACGATTTGACGC
CTCCTTTCGAAAACGGGTACTCTGACGAAGCACATCTGAGCTCTCTTCCGTCGTTGGAGATCGCGTTGCACGGACCTTTTTAGCGCCAGAACGCTCACTG
CTGCGACTTCCAGTCAAAATCAGTTTGTTCAGCTCACGGATATCCTTCCCGACCAAGGCATCGATCGAGTCTTCCTCGGGTGATACCGGCGTGTAAATTC
CCTCCGACGGTGAAGTCGCAACTGAAGTCAATGGAGATAGCGACGGTGGAGTCAATGACGGCGACGACAGAACAGGAGAACGAACTGCCGGCTTTCGACG
CTGAGGTGCTTTTACTGTCGAATGGGTAGCAGGAACACGGCGCTTTGATGCAAGAGACGATCTCTGCTTCAAAACTCGGTCGAGTCGTGGCGTGGGCATC
ACCCCCTCGCCTTCACTCTCACCTGACTCGTCTTTTGGTGCAGTTTTAACGGATCGGTTGTTTTTATTCTTCTCTGATCGATCAGATTGGAACCcccagc
tcttcttgttgctctccttcgccttcgagtGTTTCGGTGGTGATACTGTGCGCAATGGCGAGACGGTTGCGTTTGTTCCTCTCCCGGATTGTTGCTTGAG
ACTGGAAGCACTCGCTCGGAAGTCGGAAATGAGTTCGTCTAGAGATAATTCCTGTTTGTCGTCGCGATCATAACGCCAGCTTCTAGCAGCTTTGGACGAC
GTTGCGATTTTACTCCCAGCTTCGGAATCAAAGGACAACTCTAAGAACATCCTTGCAATCGTGCAGACACTTTGACCGCTTTCGGATTGAGAAGAGCAGC
TTAAACTACTAGTCGAAATGCCAACGGATAGCGATTCATCCGTTTTGCCCAGTTATTTCTGCCTGCAGTGGTTTTAACTGCATGTGCTCAAGTTGCACTA
GCGAAataatgtagccatctctAGTGTAGCCATCTGGATTACGCAATCAAGCCGTCTGCGACGTGATCCTTTTTGAGTGTTCTCACATCCTCGATGACGT
TGCTACAGTAGCCGCGTAATGCACTCCATGCAAGCAGAGTAACTGTACGTGTAgcaggttgctgctgtggtgacGGCTACCCATGACCAACCCTGCGATA
TCAAGCCATGCTGGCCAATCTCTGTCGTATACAAGCATCAAGAAGTGTCCTTTGTCCCACCATCTCCCACCCTTTCAGTGTGTGCCACGTAACTCTTTTT
CTGTTTTTCTATTGGCTGTAAATCA