Description :
From Genome Similarity Track
Location :
Scaffold_49:39449- 40870
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_49-snap-gene-0.36Conserved gene of unknown function

Sequence
1421 bases(100 bases per row)
GGCAGCCCAGGCGCAACATGGTCCTCGTGCTGCGGGATCCACTTGCTCTTGACCGGCAAAATGTGGCAGTTGATGCGCATCACCTTGAGCCCCTTGGTCA
CCTCCAGGTCCACCTGCGACCAGTTGTTGCGCTGGTCCGGCATCGTGCACACGTGGCCCACCTTCGGCTGGCCGCAGCGGCCGCACTTGTACAGCTTGCG
CTGCGCGTCCGTCTCGGCCGCCACGCTCGACGGCGACTTCTTCATGGCTCCACCGCTGCTACGGCCACTCGACGGATGGGCCTGCGCAGGCTGCAGCTCC
TCCTCCGGCACCGACAGGAAGCTCAGGTTCATCTGCGACATATCCATCGACAGACCCGTCGAGCGCACGCCCCGCCGCGACCGCGGAGGCATGTTGCTCC
CCATCGACGAGCGACGCGCGTGCAGCGACCGCGCCGCGCCGCTCGCGATCTCCGGCGGCACCTGGAACTGGTACGGGTTCGCCTGGCCCGCGACAACGGG
CGGCACCATCCCGTTCGCAAACTGCGGCTGAGGCTGAGGCTGCGGAGGCACTGGCACCGGCACTTGCTGCAGCGCCGTCGGGTCGTGGAAGCCGCCGAAC
GGGTTGACAAACTGCGACGATGGCACGCCGCCACCACTTCCCATAGGCTGCTGCTTGGACTGCTGCGCCAGCACGCGGAACTGGTCCAGGTTGTGCAGCA
GGTCCACCGGGTTCGAGTAGTGCCGCGAGTGGTGGCCGCCGCCCGGCCGCTTGCGCTTCATCTTGATCTCGTTCACGCCCTCCTGGATGCGCTGAGCGCG
GTACGCCACCATGTTCTCGCCCGTGGCCCCGACGTGCACGAGCGGCGCCTGTGTCGCGTCGGCCACCGCTGCATGGGCCTGCGCGCCATCGGTCGCGAGG
TCCGACCACTGCAGCTCCTGCAGGAACTCGTCCATCTCCTGGAACGACTCCTTGTCGCCGGCGAGACCCACGGGGGTCGACACCTGCACGGGGCCGATCG
GCAGCGGCTTCCCGTCCGCCAGCATCCCNNNNNNNNNNNNNNNNNNNNNNCCACCGCCAGGACCCATGGCCAGCGGCGACACGTTGAAGCTCTGCAGCAC
GTCCGGGTTCGACCGCACGCGCTTGTGCTTGTGCTGCGGAGCCGCGTGGTACCGCACGCCGCCGGCGCCCACCTGCCCGTTCCCGTTGAAGGAGAACGCC
AGCGGCGCCAGCATGTCCTGCTTGTCGCCCTCGCCCAGCTCCGTCTCGAACAGCTTCTGGTCGTCGTCCGCCGGCGCCGCTTGAGCCGACGCCGACGCCG
ATCCGGTCAGCGCCGCCATGAACTCGCCGCCTCCGCTGGCGTCGCCCGCCATCGCACCCGCCCCGCCGGTGGTCGCGTCCCCGAGGAACGCGTAGTCGAT
GCCCAGGCCGTCGAACAGGTC