Description :
From Genome Similarity Track
Location :
Scaffold_105:39444- 41012
Transcript NameFunction/comments
Phymu_g4419hypothetical protein

Sequence
1568 bases(100 bases per row)
TCCATCTCTCATCACGGTTTGGCTCGGCGCAAACGACGCTGCACTTTGGAACGGCAGCAACTCGGAGACGCACGTCCCGGTCGAAGAATACAAAAGCAAC
TTGATGAAGATCGTGGCGAGTTTGTGGACGACAGCACCCACCGCTTCCATTCTACTGATCACTCCACCACACGTCAACGACTCGGCTCGAGCAGAGATCG
CCACCCAGCGGAACGACTCCAAGCAAGGGCTCCTGGATCGGTCGAATGTGGTGACAAAGCAATACGCCGAAGCTTGTGTGGAAACTGCAGTTAAGATTGG
CGTCCCAGTTCTCGACCTGAACTCACACTTCAACAACATGTCGGAGTCGGAGAGAGACGCTCTGTTGGTGGATGGTCTTCACCTAAACGAAGCTGGTAAT
GCAGCGGTGGACGAACTGCTGCGAGGCAAAATTGCAACTGAGTTCTCTTATTTAAAAGAAGCTCTCGAGGTTTGGCAGTCGCCTCCCGCTAGTGTGTGGA
TAACTGAAAGCCCTTGGAAGGCGACTGGTGAGGCATAAATTTGGCGAAGCAAACAAATTTACGACTTCAGTATTTAGGAGAAAAATTAGCAAGCCAATAT
TTTTGAAAAGGCAGGAAAAAAGGAAAACAAATTACCCGGATTTGTCTCCGACATTGTAGACCACAATTATTATAGTGCGTCTAACTACTGAATTGTTTGT
GACCGTGGAGTCCACTGGAGATTCGAGACGGGAAGCTGGCGGATGGCATTCACTTCAATGCAGCAGGAAACAAAGGGGTGGTTGAGCAATTGCAGAGTAA
ACTGAGCACGCAGTTCTTTGAGTTGATCGAAAACTTGAACAATTGGCAATTTCCTGCGGGCGAGTAAGTTCCAGTGGGAAGATCCATGGCCACCGGCATT
AGGGGGTTTCAGAATCAAACATTTCGATTTTCAAATCGGTACGCATTTCGACTGTACCAGCGTGTCAAAATCCGAAGTGGTACCATTTTAAAATACGCCA
TGATACCTTGCGTAAATCCGATACCGATCTTGCTTCCCGCTCCGGAAGGTCCTGGACCTATCCCACCTTGTAGTTTTGATTTTGCTGTGCAGGCTAACAT
GGGGAAGAAGTCTCATTTAAACGCAGAAGATTTTTATGCTATCCTCGTGTGGCTAGAACACCCCTCTACCTTTGAAAGTTGTTTTGGTGTTGCTAGATAG
GGAAGCAGTCCTCGAAGACGGGTGGATTTAAGGCAATGGCTGCCAAGCTggctagcagcagcaaggggAAGTTTCGGCTCAACCCAAGGCAGATGAGAGA
TTGTTTTCAAACCTACAAGAACCGCTATATGCGTGCTAAGGAGCTCTAAATTCAACTGAGGCAGGCATCAACACGGCGGATGCAGAGAATGACATCTTCA
CCATGACGCAGAAACTAGAGTCGCGGTGTCCTTGGTACGAGAAGATAGAGGCTTTGCTCGGTAACAAGTCAAACGTTACGCCGCTGGATGTATTCGACTC
TACTGTGGGATATGAAGAGGATGCGTCGTGGTCAGGTGAGGATACGGATGGTATCTCTACTGCTACAT