Description :
From Genome Similarity Track
Location :
Scaffold_482:3944- 5676
Sequence
1732 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACATCCT
GGAGAAGTTTGGCATGGAGAACAGCAACCCTGTCAAGACCCCTCAAGACCCAGGACTCAAGTTGACCAAGGCCATGTGCGAAGGAGGATGCAACCATGAA
GAGACCATGGCCAAGGTGCCTTATCGCAATGCTGTCGGCTGCCTGATGTACCTCATGGTTGGAACTCGACCGGACCTCGCTGCGGCAGTGGGAGTTCTTA
GCCAGTTCGCGGCGGACCCGTGTCCCACACACTGGCAAGCACTCAAGCGCGTCTTCCGCTACATTCAAGGTACGAAGACGCACGGCATCGAGTTTCAAGA
AACAAGTGAAGAAGGACTCCAAGGCTACTCGGATGCGGATTGGGCTGGTGACGTCGAGACTCGACGCAGTACAAGCGGCTACGCGTTCATGATGAACGGC
GGATGCATTAGTTGGAGAAGCAAGAAGCAGCGCACGGTGGCGCTGTCATCGACGGAGGCGGAGTACATGGCGTTAACGGAAGCTGCTCAAGAAGCGATCT
GGCTCAAGGCATTCCTGTGTGAACTCGGCGAAATGAAGAACGAGGATTCTGTCATGATTTTCGAGGACAATCAAGGGTCGATTGCGCTGGCCAAGAACCC
CGAGTTTCACAAGCGCACCAAGCACATCGACATTCGCTACCACTTCGTGCGCGAGAAGGTTGAAGATGGCCAAGTGGTGTTGCAGTACTGCTCGACGAAG
GACATGAAGGCGGATCTGATGAACTGCTCGACGAAGGACATGAAGGCGGATCTGATGACCAAGCCGATCACCACGGTGCAGTTCGAATATCTTCGCAACA
AGCTGGGTATCAAGCCACCAAGCGCGGTCGAGTCGAGTGGGAGTGTTGTCAAGAAGGCGTCTCGTCCAGCTTCGGCATACCAGTAAAACCGGTTTACAAG
GACCCCGCGATGTTTACGGTAAGTCAATTGCGCAAACGGATGTATGCGCAAACAGATGATTGGACGAACAGGATGATTGGACGAGTCCATGATTGGATGC
ACCAAATGATTGGATGCAGACTAGGACGTAAGACAGAGTAAGCTCCAATAAATCAATCACTTTGCATTTTATCATCTAGTGCACAAACGACCTTCCTTTT
GTGACGAGGTCCGCCGAGTCCCTTGGTCAAGATGTCAGCCAGCATGGTCGTAGTCTCGCAGTACTCGACGATCACTTCACCGCGCTTGACTTCATCACGG
ATGTGGTGGTACTTGATGTCGATGTGCTTGGCGCGGCCATGGTTCACGGGGTTCTTCGTCATCTTGATGCACGACTGGTTATCTTCGAAAATCTTGAGAT
CCGGGGTGTCTTTGCCTGCAGCGTCGAGGATCTCACACAGAAGCTTGTGCACCCACTTGCCTTCTTGGATTGCCAGGCTCAGTGCGATGTACTCGGCTTC
ACTCGTGGAGAGAGAGACACTTGACTGCTTCTTGGATCCCCACGATACTGGTCCACCGAGAACTTGAAACAGGTAGCCCGAAGTCGACTTGCGGTCACTG
TGGTCACCAGCCCAGTCTGCATCCGAATAGCC