Description :
From Genome Similarity Track
Location :
contig_8:394357- 395793
Transcript NameFunction/comments
g2013.t1XP_009525100.1 hypothetical protein PHYSODRAFT_330193 [Phytophthora sojae

Sequence
1436 bases(100 bases per row)
AACTCACATTCAGTCTCGCATTCAGATCCAAATGTCCACCTTGAGCTGCGTGAGGCACCCACAGCATCAAGGACCCACCCCCGGTGCCCGGAAGACCCAG
GAAACCCGGACGCCAGCGATCCAGATACAAAGTCCGGCCACCCATCGCTGTGACGTTGGACTTCCACTGGGCTTTGCCGCCTGCAGCGACGTCCACTTCG
TCGACTTTGTCTCCTCCAGAAAAGATATTCACTGTGACATTCTTGGTATCGTAGCTGGTGAAGTTGATGATGACTTGGCCGTCTCCTTTTTTCGTCCACA
GCATGGTACTGTTCTGAAAGGCCTTCTGGATGGTGTTCAGGCCGAGAGTGTCGGGGTCTGTGCCGTCGTCGATCTCGCCCATGAACTGCGTGGGACCGCA
AATGGACTGGAAGTACTCGGAGATGAAACTCGAGACACCACTCATATCGAAGCCCGTGACGACCCACATGTTGAGACCCTGGTTCACCACCTTGTACGCG
TACTCCTTGGCCTTGTAGGACGTGCCGTTGTCGCTCTTGCCGGTTGTGATGAGGTCGTTAATGATGACACCGAACGTCTTGCGGAGCTTGTCACGCGTCG
TGTAGGCGGTATCCTCGTCGGACTGGGAGATCATCAACTCCATGCAGTTACTGGTCACCATGGCGATATCCGTCTTCACGAGATCCGTGTCCTGGATCTT
CACTCGCAGCTCGTCCTCCGTGATAGCAGGGTTCTGCTCCCTGAGGGCCTCAACCGTAGCCCACGTGCGTTCGACCAGTCCCTGCAAGTCGTGGCCGCAC
GTCGAGTTGGATTTCAGCGCATCTTTGAGGTATCCGATCTCTCCCTTGGTGATCATCGCGGGAGGGGCCGTGAAGTTAGCTCCCTTGATGAAAGCCGTGA
ATGAACTCCAGCTAGTAACGAGCTCGTCGTCATGGGCCAGGATCTGGGACAGGATGAACTGGGTAGACGCCATGATTCGGTCGGCCAGCCACCACATGGG
TCCTGCCTTTCCACCCAAACACAGTTTGATAGTAATGGGCAGCTCAACTACAACAGCGTTCGACTGGTACAGCAACGCCAGGATCTTGTCTTGCGAGGCT
TGCGGGTCCGCAGTTTTGATCGACGTAACGAAGAATGGCTCGGATCTCACCGACCATCATGCAAGAGCACATGACGGCAATTCGGACCCCTTTGGCCATC
TCCGAGAACTTGCCGAACCAGTTGTCCATGACGCCGTTGATTCCGACGTTGAAGACGGAGCTGACCTTGTAGAAGATCTCGCGACCGCAGTCGTCGTTCT
GGCGGATGCATTCCATGCCACATTCAACCGGGAACTCGATCGGACACTCCGTCCAACAAGTGTTAGTTGCCTCGTTGCGGTCGTACCCGCTCGGGCACAC
GTCCATGAAGTGGGCTTCGCGGTAGCACGCACTGTC