Description :
From Genome Similarity Track
Location :
Scaffold_240:39417- 41597
Transcript NameFunction/comments
Phypl_g5813hypothetical protein

Sequence
2180 bases(100 bases per row)
GCTTCTCTAGAAGTGAGTTCTCGCACGGCCCCAAGTAGATACTTCTTGATGTCGACGACCCACTTGTCTCCATCTTCTGCCCGTCCCATACGCTCCAACC
TCATCTGTTGTACAACCTCCTCCTGTAAAACGTGAGGCCGGAGCCCTTGGCGTGACCtcgccacagcagcaatcTGGATCACTTGGACATTAGATCGGAG
TACTAACCACTCATCTAGATGATTGAGCGTCGCCAATTCTTTCCATTCTGCTTCCGATGTGACCACGACCCCTTCTTCTCGTTGGAGCTCAGCGCTTGCC
AGTCGGACGGCACTCTGGTTCCAGTTTCGTTTCATGTGAAGGAATTCGTGATCTGGCCACGAtctcagcttctccatggcCTTCTGGTGTAACAGCATCA
AGCTCGGCGCCTTGCACTCGATATCGCCTCGCATTTACTGAATCACTAAGTTAGAATATTCACAGATAACCACTCGCCCCTTGTCCATGTTGGGTAGAAC
ATCGAAACACACTGTGCTCCACCAGATCACTCTTGTACTCGGATGCAGCTGAGATCACCTTCCATTCTGGTAATCTCCAAATGATTGCGCTGTAAGTGCC
TCCGCCCTCTCGGCACGAGCCGACCCATCAAAGCTAGACACTAGCAATTGCTCGTCCGGATCCACTATAGGGGGCGGCAACGCCGAGGacttcgtcctcg
cccttggTACACTTGACGATCTCCAGCATCCAACCGGAAAGGAGTACGGCCCATCGCCCCAAATCGCCCTTGTAATCCTGATGAGTGGACCAGCCACGCC
AGCGTGGAGTATTGGATCAGCTCCTTGATCGATCTCGTGACCAGTTGGGCGTAGCTCACATCCAGTACCCtgaacagcgccagcacttCTTTATCGATGA
TCCCATAGTTGATCTCGTTCGCCTTCAGCGTACAGCTCGTGAATGTTACTGGCTTGTATACCCCCATCATGTTCCTGCATCAACGCGGCTGAAATTGACC
ATTTGCTGGCATAGACAACCACTACCGGTCTTTGATCGGGATCGAAATGTTGCAGGATTGGTGCTGTCGCGATCTTGTCCTTCAGCACAGTGAATacaga
agctgctcggctCCACTTGTCCTGACTTGGTTGGCCGGCTTCGTCCCCTGTCACTTCTCTTCTCGAGTCCAGCTTCGACCGCTGAGCGATCTCGTAGAAG
TCAGCTTCCCGAAGTGCGTACAAAACTGATGCATAGACCGCAAAGTCCTCGATAAAGCGGCTATAGTAGTTGAGGCTGCCCAAAACGGGCTGTATCGACC
TTAGAGTAGTCGGGAACGGCAACTCAGCAAGCGATGATAGGTTCTTGGGGTGCGCCTCCAACCCTTCCGCCGACACTCAGTGTCCGAGGAAGTCCACCTT
TCTCAGGCCCCAGAAGATTTTGGCACCACTGATCGACAAATTCCACTCGTCATATGGATCAAGTTGCCTGTCCACTTTCCCGCACATTGTTCTCCATGAG
TCGGCTGTTATCAGAATGTCGTCAATATAAGCTCGACGACCTATCACTGAAGACACCTTGCCCGTGTCGGGTTCTCCGTCCTTGAAAACGTCGATCCGAT
CTGAGTGAACTTGGCCGTTGGTGATCTTCAGAAACCCGTACAGTGCGTTATTCAGCAGCCGCTGGTAGATCTACGGCGCGCTCTTCAACCCGAAATACAT
TCGATTCCATTCAAACAACCGTAGTAAACGCTGATAGAGCGCGTGCGCGGTCGGCAATTGAAACGACCCAGAAACCGCTGGCCATATCCAGCGGGCAATA
CCAGAGAACTTtgtcgacgtcgtcaagcaGATTGTTAATCAACGACATGGGGTACACCATCAATAGTGTCAGGCTGTTCATCAGTCTGTGATCAATGCAG
AGTATGATGTCGACACCATTCTTCTTGATTATCACGACCAAGGTGACGTGGAGTGGTTGATGATCTTCGCCGAAAGGAGACCCTTGATTAGCTAGCAGAG
CTTCTCACGAAATTGCGGGACCACTTCCTGGACGCGCTGAGCCACTGGCCTGGCGTTCCCCACATCTATATCGCAGATCCTacctctcgctgctggcggt
agGGCGTTTTCTTTCCCAATCAGGAGATTTTTCCGACGCCAAATAAGCTGGACCATTTCGGCAATCTCTTCCGGCTTAtt