Description :
From Genome Similarity Track
Location :
Scaffold_118:39415- 40975
Transcript NameFunction/comments
Hyaar_Emoy2810110hypothetical protein
Hyaar_Emoy2810111protein kinase, putative

Sequence
1560 bases(100 bases per row)
TCGTGTCTAACGTGATCCACGCTCGCTTTGGATTATTGTTAAACCTCCTCAAGGAATTTACGGTATTGAGCGCAGGTCTCTCTTTGCTCGCTGACTGCGC
GGCTCCCAGTACCTAAAGCTCTTGTTTTTTACCTGACTGACTGACGCTTTTTCTTATTTATATGGTACTAAAATACAATGCGGTGCTGAACAGATTTTCA
CGGAAAAAAAGAAAACAAATCACCTTGTCCTATTGGCACCTACCGTACCTGTAAATTACCGGCTACTCCAGTACCATGTACCGAGACGGGTATCTTATTA
AATGTGGACGCAGTGCGTACGACCCTCCAGTAAGCTCCTCTCTTTACTACTATCTGGTCTCATTGTGTACTAAACAGTGCCATTGTTGCGTAATGCTGTT
GTGTAGCAATTATTCTTTTGTGTCTTTGAAGACGGCGTGGTCAAGTTCTACTCGGAGAAGGGCGGCCTCGAAGTCGGGGAGCTCGAGATGGCCGGCCACG
TGACCAAAGTGCGTGTGGAAAAGTCGGTACCTGGGAAGTTCCCTTACCGCTTCTCTGTCTCAGCTGCTGAGGTGGTTCGGGTGGAAGGCCGGCGCATGAA
ACTGGGCGAGTCCCGCGTGACGGAATTCGCCGCTGCAACAAATGACCTCATGAAGGAGTGGGCCAACTCGCTGCATCTGTGGCGTCGCATGAACTGGAAG
GAGAACGTCAAGTTCTTCGATGCCGCGAGCGAACTCTCGCAAGCTCAAGAGCTCGAGACGCTGCAGCGCCAGATGCACTCGGTCAAAATGGCTCGTGGTC
GCTCGTTGTCGGGGAGTGCGTTTCGAAAGCCGTTTGAGCACATGATGCACGGCCAGTCGTCACCTACGATCAAGAAGCTGCGGCAGATGATGCGGCAGAC
GACAACGTGCACGGGTGCTGCATGATGAAACCGTGAAGAAAATTACTATTTGGAGAGAGAGAGAGATTTACATCAACGTACGTCCGAGTGATCGATCGAT
CATCGCCGCGAGTGCCGTCATGTATACATGTCTTGAAGCTGAGCTACCACCAGGGCGTCATAAATGCTGGTTCGACAGCTACCGAAGTCAGTTTGTGCGT
GCTGAACCACCGAGTATTTAGCTCAAGTGCAGTTGCTCGAATCTCATGAACCATAATCACTGGACGAGGGCTACCTGGCTGTGAATTTATATTTGTTGGT
ACAATAAGGAACGATGATGGCGGATGGTTGAGTAAGAGGAAGTCAAGAGACTGCTCCCGTGGAACAAACTTCCACTGACTCGGTACAGGTTCAATTCTTA
ATAAATAAACGACGTGTCTGTGTCCAGCCTTTGCTCTACTTGTTGTCCCCAGCACGTCGTAAGTAGCTCGGCGATGCATTCTAGGCCGTTCGAGCTGCTT
CCAGGTGCGTCAGAACCGCCTGGTGGATCAAATCCGAGTCCACTTGATCGGCACCTCGTAGCCACGAATGCTGCAGCGCTTCCGTCACAGTGATACGTTC
CTTCGGAGCTTGAAGCATTGACGTGATGAGGTGTCGAGCTCCAGCTGAGATCGTCCAGAG