Description :
From Genome Similarity Track
Location :
Scaffold_1036:3941- 6316
Transcript NameFunction/comments
Phyin_T30-4PITG_22060Putative uncharacterized protein

Sequence
2375 bases(100 bases per row)
TTCTGCTGCTCTCCGCATGATGCTTGTCAGCTGCAGCCTCTTCACTGCATACATTCTTGTAGAGTTTACCACCTGCGCACTGGCCAGCGTATCCGTTGCT
GCCGCGTTCGCTAAGTTTCCCGGCTCCCTCATGTTCACCACCACGTCGTCCCTTGACACCTTGTAGCCGTCCTTGAGCCTTGCTTGAGCTTGTTGTTGTT
CCCCTTCTCGATCGACCTCTTTCGATCCACCACTCACACCACTCGAAACCACCTCCTTGTGCAGAACTCGGCCGTCCTTTTCCCGAACGCAAAGAGCGAC
TGCGTGTCCACCGCGCACTTGTATGGTCCGCTCCCCCTGTCGTCGGAGCCCGTTGCTTCCGCGACGACTTGAGCGTGAACTCCCCCAGCGCGTATTCCGC
GTACACCGCAGTGCCCATACCAAGCCGTTTGGGCTCATAACCTGTAGGAAATGTAGAATCGAGTAGATGTGAATGACTTGGATTGAGCGCGTGCCAGACG
CGTTTCTGCCCCCGCCGGGGCCTCGTCAGTGGCTTTACCAATCTCGAAGTGAGAGCTAACCAACCATCCGCTAACTAAGACCTATCACTATGCCTAGATC
CTTCTAGAACCTTCCATATGCCGTAACATAGGATACTACTCTGGAGTCGATGTACGTGCACATCTTGCACTTCCAACACTCCCCCTCGACGACATGAGTC
GTAGCCGTCTTGGTCACGAGCGTACAGCCATTCTGCTGCTCTCCGCATGATGCTTGTCAGCTGCAGCCTCTTCACTGCATACATTCTTGTAGGGTTTACC
ACCTGCGCGCTGGCCAGCGTATCCGTTGCTGCCGCGTTCGCTAGGTTTCCCGGCTCCCTCATGTTCACCACCACGTCGTCCCTTGACACCTTGTAGCCGT
CCTTGAGCCTTGCTTGAGCTTGTTGTTGTTCCCCTTCTCGATCGACCTCTTTCGATCCACCACTCACACCACTCGAAACCACCTCCTTGTGCAGAACTCG
GCCGTCCTTTTCCCGAACGCAAAGAGCGACTGCGTGTCCACCGCGCACTTGTATGGTCCGCTCCCCCTGTCGTCGGAGCCCGTTGCTTCCGCGACGACTT
GAGCGTGAACTCCCCCAGCGCGTATTCCGCGTACACCGCAGTGTCCATACCAAGCCGTTTGGGCTCATAACCTGTAGGAAATGTAGAATCGAGTAGATGT
GAATGACTTGGATTGAACGCGTGCCAGACGCGGTTTCGGACCCCCGCCGGGGCCCTCGTCAGTGGCTTTACCAATCTCGAAGTGAGAACTAACCAACCAT
CCGCTAACTACGACCTATCACTATGCCTAGACCCTTCTAGAACCTTCCATATACCGTAACATAGGATACTACTCTGGAGTCGATGTACGTGCACATCTTG
CACTTCCAACACTCCCCCTCGACGACATGAGTCGTAGCCGTCTTGGTCACGAGTGTACAGCCATCGGCTGCTCTCCGCATGATGCTTGTCATCTGCAGCC
TCTTCACTGCATACATTCTTGTAGGGTTTACCACCTGCGCGCTGGCCAGCGTAACCGTTGCTGCCGCGATCGCTAGGTTTCCCGGCTCCCTCATGTTCAC
CACCACGTCGTCTCTTGACACCTTGTAGCCGTCCTTAAGCCTTGCTTGATAGAGCTTGTTGTTGTTCTCCTTCTCGATCGACCTCTTTCGATCCACCACT
CCACACCACTCGAAACCCACCTTCTTGTTGCCAAAACTCGGCCGTCCTTTTCCCAAATGCAAAGAGCGACTGCGTGTCCATCGCGCACTTGTATGTTCCG
CTCCCCCTGTCGTCGGAGCCCGTTGCTTCCGCGACGACTTGAGCGTGAACTCCCCCAGCGCGTATTCCGCGTACACCGCAGTGCCCATACCAAGCCGTTT
GGGCTCATAACCTGTAGGAAATGTAGAATCGAGTAGATGTGAATGACTTGGATTGAACGCGCGCCAGACGCGTTTCGGCCCCCGCCGGGGCCTCGTCAGT
GGCTTTACCAATCTCGAAGTGAGAACTAACAAACCATCCGCTAGCTAAGACCTATCACTATGTCTAGATCCTTCTAGAACCTTCCATATGCCGTAACATA
GGATACTACTCTGGAGTCGATGTACGTGCACATCTTGCACTTCCAACAGTAAGCAAGTAACGGACACCCCAGACCCGTTACACCACCGGTCCGCAGTGTA
TCCGATCAATATCTATACATACGCCCCGGAGAGAACCCGGACGGACAGAATGGTGGGGACTACTTCTTAGTAAAGCAAGCGCGTATCGCGCACTACCAAC
AGACATGCATTGGATTCAAGAAACCCAACACCATGTTGGACGCGTGTGTATCATTACGTAGAAACGGTGGCGAAG