Description :
From Genome Similarity Track
Location :
scaffold_22:394079- 398458
Transcript NameFunction/comments
g3335.t1hypothetical protein

Sequence
4379 bases(100 bases per row)
TACGAATACGCCCGACTGCCGCCTCCTGTACCAGGCGGACACTGGTAATCCTGCGGCAGCATGTAGTTCTGCAGCGCACTGAAGCAATACTGTGCCTTGC
CAATGTTCTTCCGTGCATTCTCGCGCCGGACCCCGTATGTGCGAAGCAAGTTGGTGAATGCTTCCCCATCATCTGCAAGGAGTCCGTGGGAGCGCACAAG
AAGGTTGGCTTCTTCGAGCGTGATCGACATCGAAGTGCGATCTTTGGCCGATTTGCACATCGTCACTCGACCGCCGCCAACGGAGCGCGCAATGGACGAC
GACAAACTCAGGATAGACATACGCTTGGATCGCCCTGATAGCTGAATGCCGACCTTGAGAGCCATGAGAGACGTTTGAATCCGATCAAGGTCCTCCGCAT
CGTAAATGGCAGCTGATTCCTCATCTCTGCTCTGTTTCTTGGACACCCATTCAGCAAACCTGTCCACATACGCCTCCAGCTCGACCACGTTCTCTGCGTT
TATCTCCTTTTGTAAAGAAGACTTGCCAACAGTATTAGCGACCGTCTGCATTTCATTCAGCCCTTGTGAAAAGATCACTGGCACCACGCAGATGGGTTTC
TGGAAAATAAACTTGGCGCGCATCTTCTGCTCCGGCGTTGATAGCGGCAAATAAATTGCCCCTGAGATCGCGTCCTGGCCTGGAACCCGGTGCATGCTCC
GATCCGGAAACTCGCTCCCACGACGCGTGATGATAGGGAGCTCGATCACGATACCCGATGGCCCAGAAGTGATTGAGACGCGAAAAGAAGCAGCGCGTGG
TGACTTCACAGGTCTCAGCTTGATGTGGATACGTCCGAGCTCCTTTACGGCAGCTTCCGTGTCGCCCAACATCCCCAACTCGTTGCCATATGTAGAGAGT
AAGCTTTCCACCGAAAACAAGAAGCCAACCCTTGTAAGCATTTCCAAGTAGTCGATGCCGCAAGCCTTCAGCGGATGGGGACCGAAATCCAAGTGGTCGT
GCGCATGGACGTACAGCGTTTGTTGGAAGCACGTGACGAGGGCACTCATCGCTTGGCAGAACGCTACCTCGAGCCGACGCTCCACATCCCATTTGAGCTC
GTTATACTTGCGCTCCAACGCGTCCATTGTGAGATCCGAGCTCGCCTGTGCTTCTTTTACAAGCCGCCCATGAAGCCTCTCTAACTCTTCACGCATCTGA
CGAACGCCGCCACTCTTGAATCCGTATACATGTGCTGCAAAAGCACCGACCGTCGTCGTGCCGTACATCCGATGCTTGTGAAAAGGAACTCGGCCTCTAG
CCCTCGTGTTAATCGACAGCGAAGGGTTTTTCGACTGCGCGCTCGAAACTGAGCCCTCTGGAGACCCATCACCATCGTTGGTTGATACGGCCCGCTTCAC
TTCGTCGGCATCAACACTGATTGGTGCTACGTCAGCAATGACATCCGTCGTCATATCCGACGAGTCAACAGTATCATCAATGCCATAGATACTCTCGAAT
TCCTCCTCAGTAATTCCCATCGCCACAATGGTTTCTGCCAGCTTTCGTTGCTCAGAAGGAACAGAAATGGCTTGGCCTGAAGCTCCCTTGTTGACAATAG
TCTCAGCAGAGTCAAATGATATCACGCGCCGACGGAGGGCCTCTACAGGCTCAAGAGGCGATTCTTCGGAGGGTGGAGAAAATACGATCTCTTTCTCGTC
GTTGATATCATCATCGATGAACTGCACGGAATCGAGGTCAGTCTGCTGTCCGCGCACGCTGGATTCTCTCGACAAGTGCAATGGTGACGACATTAGCGTC
CCGACAAATGAATTCACAAGACGGGCGTAGCGCGCCGCGCTAGTTTGGTCGCCGTATTGGACGTCTTTTTCAGACGTAGGGGCTGCATTACCCACAGTCA
TCAATTGCTGATGAAGATTCAACGCCAGGAAACGTAGATCCGCGTCTGCTTTCATAGTGCTTGGTTTGAAAGTGAGCCCCGCATGCTGCGTAGTTCCGTA
CCGTAAAATCGAGTCTTCCACCTCCGATATGTACTGCTCCATTGTTTTGACAAGATCCAGACGCCACTTTCGCTTTTTGCGCTCAATGGCGTCATCTTGA
ATCTGAATGATCATCTCCGATAGCATTCCGACGCTGGTTGCCGGCCTAACTCGGTTCTCAAATTGAAGCGAAGAGCTCATTCCGGATGCACCAGATCGCA
GCGATTCTGAGTCTTCCGACGACTGTGTCATGTTAGTCCTATCATGCTCTTGCACAGTGCCGAGGGCTCTCGGAGAGGAAGGAATCGCTGAGGGTAGTGA
ATAACCACCGACGCTTGGGGTTGACAATTGACTGGAGGGGGTCGACGATGAGCTTTCATCTCCATCCTCAGCCGCAATTTCGCGCTTTAGCGAGTCAAGT
TTGACCAGCAAGTCAGACAAGATCAACTGGAGCAATTGATAAGGTACCTCCCAAGTGTACACACTTTCGATCAGCTCTTCTTCGACCAGCATTTTTCCTT
GTGAGCGTTGGGAGGTGGATGCAAGATTGATCATCTGCTGAGCAATCTCCGAGTACGTTGAATCATCGCGGGGCGAGACATCATCTGCATCGGTATTGTT
AATTCCGATATACATGAATGATCGAGTGATGCGCTCGAGCCCGCCAACAGACATTCCGGCGTGTAAACCTTTTACCTCCGCTTCGCAGCGAATAACGATT
TCACCTGAGGATTGCGTCCGAGATAGCGGGGAATACAGCGAAAAAATGGACGCCCGTCCGATTGGGGGTGTTGAGCCCGTCATAAATGACGAAAGCGGAA
CAAGCGGGTCTCCGACAAGCCACTGGCTATTCAGGTCCTCCAATGAGTTCTCATTTCGAACCGAGTACACCGAGGCGCGGAGCAAATCCTGCTCGCGCAT
TTCAACGGCCACCATCATGTGGAAACACGGGTCCTCAGAATGCGAGATCTCGGTTCGGCCAACCTCGGTCAGTACTGCGCCTGTCTCGGCATTCATAAGG
TGTAGCACAACAAACGATGATGACGTCAGCGATGATTTCGAGGGCAGCTTCAAATTGAAGCACTGAAACGATAACCACGCGCACGGCACATTTTGTGAAG
CAGACCGTGCTGGCCATCTCGTGTCATCGCTCCATGACCCATCGGACACAGCCACCTGTGTTGCCTGTCGCTCGTACTCGGACGCTGACGGCGAGCCTGC
ACTGCTCGTTGAATCAAGCCTTGCAGACCTGCCACTTTGCTGTTGCTGCTCTGAGTTTCCTCCACCCAAATGCTGGCGAACCACAAGCTCCAATCGTCGT
TTCGCGCGGTCCAACACGCTACTTCCAAGCCCCAGGGACAACGGACTTGGGCGTCGACCAACCGTCAAGTACCCTCCCTGTGAGCCCGGAGGCGAGTTGG
GTGGCGCCGCTCGGGCGACGGCATCCCCACGATTCTTGGCTGCTACCAGCAGCGGCCTGGGCAGCACCTCGTTGTCCAGCAGCGGGGTGGCCTCGGACGT
GACTCGACCGTTGTTGTAGCTCAGGCTCCTGCGCGACGGGATCTCGAGCGTCGGCTCCACTTCCCACATGAGCACCATGAAGAGCACGCAGGGTGCAATC
TCGGGGATGGCGTAGCCCACAATGACGCACACGTCGGGGCTGTGGATGTCTCCACATCCCTGGTGAGAGAAAGGTCGTTGAATGTACATGATTGTCCTTA
GTAGGAAGAGCGCCGAGCACGCCCCCATGACGAGCCCCGTGAAGCGCAGCGCCCGCGTGAGCTTCCGCTCCACCCGCTCGTCCAGTCTGCGTCTCAGGCC
GTCGCCCGAGGGTCGCAGCACACGCTCCACGCGCAGGCGCATCTGCCACGTTGAGTAGAGCAGCCCCAGCGAGCTCACGAGGCTGCCCGCGGCGATCAGT
AGCACGGGCAGGACGCCCGTCCAGAGCGTAGCGCGCTTAAGCCGCTGGTGCTTGCTGCGGGCTTCGGCCACCGCAGCCTCGTGCAGCAGTGAGAGCCCCA
GCACGAAGGCATAGAACAGCCCGTTTGCCAGCACGAAGGCCACCCAGATGCGTCTCGAGCGGCGCGAGACCTTCGGGTTGGCGATGTCGATCCACCAGAG
CGTCTGGAAGAGCACGAGGCTGAAGAACAGGCACAGCGCCGCGCGGTTCAGCACGTTGCGCAGTACGCCCTGGCTCACGAATGACGCGGCCCGGAACAAC
GCAAAGAGCACCATGAGCCGCTGGAACGTGCTGCGCTGGAAAGAAGTGGCCTGCGCGCGGCACGCGGCCACGAGGGCCAGAGACACGTACAGCGCCACGC
ACAGCAACTCGAGCGCCGAGGACGCGCGCGGCAGGAACACGAGGCCGTCATCCACGTCGGAGGGGGAGGCCATGGGCGC