Description :
From Genome Similarity Track
Location :
scaffold_38:394068- 431397
Transcript NameFunction/comments
g12763.t1 conserved hypothetical protein
g12764.t1 hypothetical protein PHYSODRAFT_466952
g12765.t1hypothetical protein
g12766.t1 conserved hypothetical protein
g12767.t1hypothetical protein
g12768.t1 ATP-dependent RNA helicase, putative
g12769.t1 hypothetical protein PHYSODRAFT_467769
g12770.t1 conserved hypothetical protein
g12771.t1 hypothetical protein PHYSODRAFT_467909
g12772.t1hypothetical protein
g12773.t1hypothetical protein
g12774.t1 conserved hypothetical protein

Sequence
37329 bases(100 bases per row)
CTGCACCTCGTAGTCGTACCGACAGCTAGCTCGCAACACGGCGGATTTCTTGGTCCCCATGATGACGGCACAGGAATGGACTACTTGGAAGGAGCAGCTC
AGCCATGTCACCTACGACAAGGCCTTGTACGATTAGAACTTTCGTCATGCACGCCGTTCCGTTGCCGACTCGTTTATCGGCTCTGCAAAATATGCCATAC
GCCAGCAGACAGCTTCGGAGGTATCCGCGCTTGCATCCTCCTAGCTGGAGCCAACTGGCTGACTGGCTGACTGCTTGCGCTCGCGTCCGTCCACCATCCA
GAAAAGATAAACATTAACACCACAGGAAACACGCGGGCTTTCTTTTTCTTTCGTTTTGGGTATTGCCTGGTCTCGCCGCCTTCGCTCTCGCGACGTTTAT
GTGAGCTTCTTGTTCGCTTCACACGCGGCCTTCTCAATGTGTGCATCTCCATCGCTTCCATGCCATTGATCTACATGTCCACGTCTGTCGTCAATGACTA
CAACTCGTCATCTCCTTCTCAAGACTCCATAGCAGCGTCCGGGGCCGGCTCGCCCTCCGTCTTGGTGGTGGTGGCGGTGGCTTGCGTCGGCTTGGCAGCC
CAGTAGTCCTCCATCTGACGGTCCAATTGGGCAGCCTTGGGGTCGGGGCCCTTGCCGGCTTCGTGCCAGTACTCGTCCATTTCCATGTCGAGGTCTTCTC
CGCTCTGAGGCTTGGCGTCTCCGCGTCCACCACGGCCTCCACGTCCGCCTCGACCACCTCGACCACCTCCACGGCCTCCACGGCCGCCTCGGCCACCTCG
ACCACCTCCACGACCCGCGCCCCTTCCTCCGTTCTGCTGGGGAGTCGCATTCTTGTTCTTCAGGCTGTTCTTGGGCTTGGTCTCCTGGGGCGGGAGGCCC
TTCCTGTGCTTGCTCACGACCTGCTGGCGCTTGTTGCGGTTGTTTTGGGCGACCTGCTGCAGCTTTTTCTGCTGTTGCTGCTGTTGGATTTGCTTCTTGG
TGGGGGCGTTGCCCATCTTCTTCTTGCCGACCGCTACACGCAGAACCGGTTGCGTCTTCTTCCGCTGCTGCTGCATCTTAACGACCGTGACCTGGTGCTG
CTGCTTTTTCGGCTGCGGCGCCGTCTCCTCCGCCAGGTGCGTGAAGCGACTGGACAGCGGGACGGCTGACACGCCGATCACGCCGCGAGGGCCCTTCTTG
CCCGGCTGCGGCTGCTGCTGGTTGTTGTTGATCTTGCGCTGGCCGCGGACGGACGCCCGCGGGGCTCCGGATCGCCGATGCATTCTTGGAGTCTGAGCAG
CTCTTTTGCTTTGTGAGCTTTCCATCGGATTCTTTCAGTTGCGTGAAGCCTTTATGTTGCGCTTAAAGTTTCACGCACCTTTAACACCGCGCGCAACTTC
GGCGAGTAGTTTAAAAAACCGACACCAAGGCTGGCATGGAGACGGAGCTGGCGGCCCAGGTGCAGCGCTATCTGGATGCGTACGTGTACGAGAACGCGCG
GTTCCTAGCAGAGCGACTCGTGGCGCAGGTAAACAACCGCTTGGATCGGATTTGAACGCACTGAAAGCTGCGATGCTGCTGTTTTAAACGCAATAAGTAT
CTACGTCATTTTAACACTTTTTGACCATTTATCGCTGTTACACGCAGCGTCCGAGCGAGGAGAACGTTCTGCTGTTAGCCACGTGCTACTACCGCAATGG
ACAGGCAGCTCGGGCGTCGGCGGTGCTGAGTGGCGCCACACGACCGGATAATCGCTACTTGCTGGCTTGCTGCTGCTTCCAGCAGGGACAACTGGTCGAG
GCGGAGAACGCGCTGCTAGGAGGTGAAAACTGCCACGTCGATGATGCAGAGACAGTTGAGAACATACCTGCGGGAGCTGCTGGGTTGTTTCTACTTGGAA
AAGTGTGCAGGCGTGGAAACAGGAGACAGCAGGCTGTTGCCTGCTTCGTGAAGAGGTGAGACGATGTTTCGGTTGATTGATTTTGTGGCGAGTTTATTGA
TCTTTGTGTTTGTGTTTGCGTTGTGTTGTGTTGGCGACGGAGTTAGTTTGGAGGTGGATCCGTTCATGTGGTCGGCGTACGAGCAGCTTTGCGAGCTTGG
AGCCAATCTCGAGGCCTCGAGATTTTTCGGCGCAGCAAGCACCGGATCGGCAAATGAAGTGGATTCCGAATTTTCACTTTGCCCGGAGTTTAGCGATGCA
AGTGTTAAAGGTGGACATCAATTTGGTGATGAGGAAGGACACTACCGCGAGGACAACAACCCAGAGGATCGATCCACGGACGGAACATTGGGAACACCGG
AGACTCCACTTTGTTTTCGCCCTTATACGCCTAAGAGCATTTTGACCTCATCGTTGAGCGCTTCTCGACCTATGGGTTATAAAACACCAATTGTCAACAG
CAATAACGGGAAAGGTATGCATACAGCGACAGCCGTGAAGAAGCCGCGAATTGCAGATGATATTGGTGCTCCTGTACGACACAGGAAGGTTCATCGGCGA
CCTCTCGCAGACAGTGACGAAAAGAACCGAACCATTGCAAGGCTGTCATTCTCTGCTGCTGGCTTCGACGACTCTCCACTGGTACGGAACCAATCAATAT
TGTACTTGAATGTAAACGTAGTGGGCTGACTCATTATATTTTATCTGCGCAGAATCCGTCGAAATTAGCATTAGGCTCTCCCACGTCTCCACTCGTTACC
AACAAGACTCCTGGCCCTTTCCATAGAGAAGGATCATCACGTAATGGCCGGGAAGAGTTGCTCCGCCTGCTGAGTTCGTTTGGCTCTATTTATCAAATGT
TGAGTGTGTACAAGTGTCTAGAAGCACTGGAAATGCTGGAACGGCTTCCTGACGCTCAGCGTGCATCCGGTTGGGCACAGCAACAGACTGGTCGAGCACA
TTTCGAAATGGCGGACTACGTGCGAGCGCACGAGGTGTTCTGTGCTTTGCACAGAGCGGAACCGCATCGGATGGAAGGTCTCGACATGCACTCAACGACA
TTATGGCATCTTAAGGAGGAGGTGGAACTGTCGTATTTGGCTCAGCAAGCAACAGACTTTGACAAGTTATCGAGCGAGGCCTGGTGTGTTGCTGGCAATT
GTTTTAGCCTTCAAAAAGAGCACGACACAGCGTTGGCCTTCTTTCAGCGGGTAAGTTGGTTCGGTTGTATCACGAGAGTTCAAATTGGCATTGCTGACGT
ATCCTACGGTATGTCTGCTATTAGGCTATTCAACTGGACCCGTCGTTCACATACGCGTACACGCTCTCTGGTCACGAGTACGTCGCAAATGAAGATTTCG
AGAAGGCAGTGAATTGCTACCGGCATGCAATTCGTACCGATTCACGGCACTATAATGCGTGGTACGGCCTGGGCGCGATCTACTACCGGCAAGAAAAGTT
CGAGTTCGCCGAGTACCATTTCAAGCGTGCGCTCGAGATCAATCCTCGGAGCTCGCTGCTGCACTGCTTCCTAGGTATGGTTCTACACGCCACCCAACGG
TGTGACGAAGCCCTGACCACCCTCGCCACCGCCGCCGAGCTCCAGCCATTAAACCCCCAAGCTCGGTTCCAGCGTGCCAATGTCTTGATCACCCAACAGC
GATACAAAGATGCTCTCGCAGAACTCCATGTCGTCAAGAACTTTGCGCCGCGCGAATCCTCGGTGCACTTCATGATGGGCAAAGTGGCCAAGAAGCTCGG
CCGAACCGAGGAGGCGATGAAGTACTTCACCTTGGCGCTGCACTTCCACCCGAAGGACAATAACCAGATCAAAATCGCCATCGACAAAATCAACGAACCG
GACCATGACGACGACGACCGCATGTAGCGAGTCATCGATGCATCTGCAGCGCCAAAGCAGTAGCCTACGATATACTTTGAGGTAGATAACAGCAGCATCA
ATGAAGCTTTTTCACCGGCCACATAGACATGGCCGTTTTGCTTTTATGTGGCATTTGAGATGGTGCCGCCAACAGTGAAAGTCGAGGCGCTGCTGCTGCT
GCAGCAACTCACGCTGTTCAAGGAGGCGAGCGAGGCACTCACCCGTCTGTTCGAAGGGTTCTCTGAGCAGGATTCCGGGCGCTGCGCCGTGCTGTGGCAG
CTTCTGCAATGGCAAAGCACAACCGCGTCCAGCAGCCTCGAGGATGTGCTGGTCGACTTAAAATCTAGCGGTGACAGCAGCCAGACGGAGGTGCGTAGCG
ATATGGAGCTCACGGTGCTGGGCAAACCTGCTCTGCTGTTTGCCGCCTCCATCTACGACGAGGAACTCGCCATGTTGATCTGGTCGGGGTTCGTCCAGTT
CCACGCGCGCTACCCGCAGTTTGATCTGCCGCGGCAGGTGCTGGACAACTCGGACGACTCTTTGGGCTATTCGGCGCTGCATTATGCCGTGGAAGCGCAG
ATGACGGACTTCCTGCGTGCTGTGTGCAAGGAGATGACCCAAGCGCAGACAGCTCCTCTTGTCGGCCGAGTTGTGACGCAAGACGTGACTTTGCCAGTTA
ACACCGCGCACACCATGGGCAAGAACATTGCCAGTGGAGGCTGCTCGCTGCTTCATCTTGCGGCCAAGAAGGGCGAGTTGGAGATGGTGCAAATGCTGAT
TGCACCCCCGATGCTCATGGACCCCAAGACACTGCGCGACTGGGACGGCAACTCTCCTGCTCGAGTGGCAGCCATCCACGGACGTGACGAGGTCGCTGCC
TTTCTAGAGGTACGGAAGTGCCAGAGCAGTTTGCGAAGTAGGTATTCTAATGGTTATTGTGGTGACTGCTTAGGGTATCACTGGGGAAGCACCATTGAGT
GTTTCGGAAGTCGATGACCTGCGAGCCAAGCGCGAGAAGATGGCCAGAGAGCGTTACCTGGCACACCTGAAGCCCCAGGAGTCCATGCTAGAGCCTTCAG
TGTTTGCCAATATTTGGACTCTCGAGGAATCGACGCTGATCAGCGATGAAGTCAACCTCTTGGCCGCTGAGCAGGGTTGGTGCAAGGAACGGCACGCGTC
TTATCAAACGACGGACATGCCGTGCCACCACGTTGCTGGATTGAACTCCTGGGTGCGCGCGACCTTGGCGGACAGGCTCTTCCCTCAAATTGCGAAGCGG
TACAAGCTCCCCAAGAACCAGCGACTGCTTTTCCGTGACCTCTTTTTCGTCAAATACGAGGCACGCAATGGTGAACGTTCTGAGCTTGCACTCCATCGCG
ACGGATCCGTGTTGTCTTTTAATGTGCTACTGAACTCGGCCGACGACTTCACGGGCGGTGGCACCTACTTCGACGCCACAAAACGCACGGTGCACATTAC
ACAAGGCGATGCAGCAGTTCATAGCGGAAAGGTTCTTCACGCCGGTGCCCCTGTGCTGTCAGGCATACGCCAAATTCTTGTGGGCTTCCTGGACGTCGCC
GACTGTGTGTACTGAGTGCCTTCACACTCACAAACGGCGAAATTGAATGCCTTCTATAGGCGTGTCTCCTTCAAGCACGTAGAGTCTCGGACACCAATGC
TTGTCATCGTACAGGTCGTCTTCTAGAGAAGTTTGGATGGAACTAGTGGCTTTAGCCTTCCCGAACGCAACACCACACACAACATTAGCAACACGATCCA
AATAATAGAGCATACTTCAAAGTAGACAACTGAGACCATAACGTACCCGTTCGAGTTCAAAGAAGAGCAAGCGGTCTTCCCAAATTTTGTCGTAAGTGTT
CCCCAGCATCTACAACAATAAAAACAACAGCCGCAGCAGCTGATTAGACATGCTCGTGATGTTCATTGCTGTAAATACTGTACGTACGGCAATCAAGAGA
TTTAGGAGCATGATAGTGCCGATGACCACGAATGAAATGAAAAAGATCATTGCAAGCAGACCGCCTTCTGCGATGCTATCCCAATCCCATGAACCCAGAC
TAATGTTGAATGTCGTAGTCAGCGCAGTAAAATAGCTCTTGCATCCCTCCAGCTTCAAGCACAACAAAACCAGAGATATGCTAAATATTTTTCGTGCTCG
TCCCAATATAACGCGCATCGACTGCATCGTACCTGAAGTATGAAAAACGCAAAGGCAAAGCCGCCCAGGAACACGCAGAATACCATGAGGAAAACCAGGA
TGTCGGAGAACATCTGCAGAAAGGTGAGTGCACAGTTAGCCCGGAGTTAGATACATTCCGTTGGACAGCGAACCCAACCTTCGCAATCATGCGAACAAAT
GGGCCGAGTGCTCTGGTGCCTCGTGCAAATTGAATCCACTTGACGAAGATTTGCGGTCCGACAATGCTCATAAGCGTGATACGGAAATTGTATCGCCTTC
GAATGTTGGAGCTGTACAACGATTCTTGGTAGACGATGAGGCGGAAGTCGTCGTGATCGAAGTCTTGAATGAACACGAAGGTGTTCGTTAACCCTAGAGT
TAAGCGAGAGGAAGAAGTCACATGTACCATCAATTTACCTGGAAATATGAGCTCGAGGATCTCTGCGACGAGTAGGAGCCATACACAAGCAATTTGCACC
AGGTCGAACCAATTCCATCCATCTCGTAGGTATACACGAAGACTTCCGCATTCTCTGTATGCTTGATACTAATAAGGACACAAAACAGTTTAACCCGCGG
AAACCAGTGCCTATGGGACTACAGCATATAACTGTACCTCTTGGAGCGTGTACTTCGCGTTGATGACAGAGTAGACGAGTCGTGCTACATCTCGAACGTA
TTCCATGCACCCAACCGTTTCGTTGAAAATGTTATTGCGATAGCCTCCAAGTGGCATTCCCACAAACGTGTCACCCACATGCAAGTACCTGGGGTCCAAT
CCAGGTGTCAGCTGTTGCTAGACTTCATTGCCCATACACAATCAGAGAGTGGACGTACGTGGCAACGAAAACGGCAATAAAGTAAATGAAGTACACTTTG
AACTCGGACCTAAATGTCTGTCGCGTGAAAGAGTTCCATCTGCAGTGACAAACTTTAACCCCAAGCAATTTATGACGTCATTGCAATCATTACATGGCGA
TACGTACTTGTGGTCCAATAACTGTCGGAACCACGGGTGGAAAATGAGATCCTTGCATTCTGTCTGTCCCCCGTTAAGTCACGTTGATAGATCGTCAAGT
TGGGCTGATTAACCCAATCCAAAGATTAAAGCACCCTACCTGCACTATCAGCCACAATGTTGGGCTGTGTCGGCCCCGAAACTCTGCGTGGTCGTAGACA
TATTCATACAAAATTCCTTTGGGCTCGCACACAATTCTTTCTTTATGCCCAGTTTCATTCTCCGTCACAGTAAACACGTGCTGGACGCTCAATACACTCC
TGATGTGACGCAGAAATTTCCACACTTTCTTCAAGGTTTTCCTCAACCTGTCGACTACGCGTTGCATTACACCCTGACTTCGCTTGCGTCGAGGAGAGCG
ACCAACTTTTCCCTGGCCCTTCATCTGGACGATCAATGCGTCTCGCTTCTCGTGCAATGTTTTGATATCATTGCCAACTGTCCAGGATTGGTTGCGTTCT
CGAACATGTCTTAGCATACTGCACCGGAACAATGGAATACGGAACGAATCCATTGCCAACACGGCTGCTTCAGGGACGTTCTGGATCAACAGGTGGAACA
GTTTGCTTCTCTCGTGTAGCTCCCGTGCTTTGTTCATTTCATAAATGGTCACATGCTCAGACACAACGAGTATACCCAGCGTTTTTCGTGGTAAAATTGA
ATACCCGGGTGCTGACCGGAAGAACATGATGTCACGGCGATTTTTCGTGCATAAGAATGGAGATGTTAGTAAGCTGTCGACGTTGGAGCATGTGCTGTCA
TTCGCAGTACCGACAGCGTCGTGACGCGCATTAGCCCTTCCTGCCACAGTTTCAGGCGACACCGTGGCGGTATTTCCAGCTAAGATCTGGTGTTGCGGCG
GATGAGTTTTGGCTGCAGGTGGACGTTTGTGCTGAACCATAGCTCCCGAGCGAATGTTCACTGATGGCAATAGCTTGGCCATCGCTTTTCCATCAGGAGA
TTCCACAAACGTCCCTCGCAGGGCAGTTCCATTCACCATGGTGAATGACACATATCGCGACATCCGAACATCGGCATGATTCTCCACGAGATGAAGACAA
ACTCCACGACGTTGACTAGCTATCGCAAAGTGAAGTCTATGCGTGAAAATAAGAGTAGTTAGTGCAAAGAAGTAAGCCGGGGCACAGCGATTTTTACGTT
GATGTGACCACTAGGCATACTTACGGTGTCTCTCCGGCTTTGTTTTGAGCATTAATGTTCGCCCCATTTGTCAATAGAAGCTTGCACAACGTGAGATGCC
CACCTTCAGCAGCAAAATGGAGTGGCGTGTTGCCAGCTGCATCTTTCGATAGAACCAAGGGGTGACCACAAATTTGCAAAAGATCCTGCAATGTGATGGC
ATCCTCGTGCAGCTTGTCGAGAGAGTCCGAGAAGCGAGCGAAAGATACGCCAACATTTGCCACGAGAGCTCTCATCTCAACATCCGACTCACTCACCAGC
CGCTTAGCTTTACGCATTTCGAGAATCATCTCCAGCAGGTGAGTGAGTTGCATGAAGCTGTACTTTTGGTATGGAGAGTTCATTGGGTGCTCGTTCCAAT
GCATGATCAGCTCGCTAACGAGAGCCGTATATCCTCGTTGAGTCGCTGCGTGCGTCACCGTGTACCTGCAAGACGAGAAGCTTCAGTATACTGCATCAAA
CCGTCAATGCAGCACGGAGGTACGTACTGAGCTAAACCGTGTGGTTGCAGGAGGTCGAGTCCGTCATTCGCTTCGTTCCGCAGGATCCGAAGGATCTTTG
GTAGATTAGGTTCTGCAAGTCGAAGGACGCCGCTTTCAGTCCTCATTGGTCCAGGCACAAGTGGTCTGCATTGGCAGCACTCATCAAAGAGTAGCTTGCT
TTGCAGCGCGAGGTGCTGTTCATCTCGCTTCTCCAGCAGTAGGTGCATCCGATAGTATCTACGCATGGCTCGGTTGATTTTATCCGCCGCCCAGCCCTCG
GGTCGCTCATCATGGTCATGTCGAAACTGACCTGCTAGGAACTTCTTGATGTAGTTTCCGCCTTGCACCATGCGCGTCGGACTCTCCTTGATTTCGTTCT
TCCCTGTGTGCGGGGTATTGTAACGAATGTGCTGCGCTCGAATATGTTCTTGCCTGAGCTGCAGACGTGGAGGTCGTTTGCGCACGTCTTCCAAAATCAC
CTGCTTATGCTGCCTCTTCTTGTTCGCTCGAGCCTCCTGCTCGTCCACGCAGCAAAGTCAGCAAACAGTACTAAAAGCCCTCCAATTCGATCAAAACGCC
ACCTTGATATGCGCTCGATACGCCTCCAGCATCTCGTCACGCGTCGCCGGAATCCCCGCAGACTGCATCGCCGTAGTGTAGCGCTTTGCAGACTCGGACG
CCTTCTCCAGATTCTCAAAGATCGCCCAAAAATTAAGACGGTTTAGATATGGACTTTCGATTTCCATATTTAACAAACACACTATCGGAAGTGTCGTATT
GATTTGCTTTTTGTATTACATTTATTGGCCGGAATGGTGGAGGACGCCTTAGCTGCTGCATCCATGGACGGCGAGTTCTTCTCGTTCCCGTACACGCCGT
ACTCCATCCAGCTGGACCTGATGCATCAGCTGTGGGAGACGCTGGAGCAGGGCCACTGCGGCATCTTCGAGAGTCCTACAGGCACGGGTAAGTCCATCAG
CCTCATCTGCGGCGCGCTCACATGGCTCACGAGGCACACGGACGAGTTCGGACTGCTGCAAGCGCTGGGGACTACAGATAAAGTCGATGCAATTGATACG
GAAGCAGAAAAACGCAAGAAAATTGCCGAACCGAGTTGGCTCGACGACTTCGAGCAGAGGAAGGCGGATCGGGAGGTCAAGTATCGCCAGCAGGTGGCTA
AGAACGCGCTGGCTGGGATCAGGAAGCTCCGACTAGAGCCGGAGGCCACCACGAAGAAGCGCAAAATGCGGCATGCGTACAACCATCAAGAGCGGAAGCG
GGTGCATCAGGGCAGCAGCAAAGTGACCAAGGACGGAGAAGACGAACACTTGGTGGACGCCTACGACAGCGATCGTGTAAGTCGCCAAACTAGTGACAAT
GAGGAAGAGAGCGGCGGGGGTTCGCTGGGGGTGAGAGGTCGTTTTGGAGACGAGAAGCCGGATTTCGGCGTCGTGAAGATCATTTACTGTAGTCGAACGC
ACTCGCAGATCTCGCAGTTTGTCAGGGAAATACGAAAGACGGTGTTTGCGGAGCATATCCGAGTGGTGTCTCTGGGCTCTCGCAAGAATTTGTGCACAAA
CCCGGATGTTACGAAGCTGGGCTCGGATTTGAGAATGGCGGACAAATGTCTGGATATGATGCAAGGCGGCAAGAGCAAGAAAGGCAAGAAAGTCGGCAAG
TGCCCGTTCTATGAGAAAGAGCTGCTCGGTCACTACAAAGACTATGCCCTCGTGAGTCTCGTGTTTTATTTATTGTTTTTGGTGCCTGAGTGATTAACAA
GTTACCGTTTGTGCAGGCTGAAGTGCAGGACATTGAGGACCTGCACACGCTGGGTGAAGAAATGTCTATTTGCTCGTACTACGGCACTCGTGAGAGCATC
TCGCTTGCTCAAATTGTCACGGTGCCGTATTCCATGTTACTGAGCAAAGATACCCGGGAGACACTGGGCATTGCACTGGAAGATAACATTGTCATCTTTG
ACGAGGCGCACAACATCATTGATGCAATCAACAACACGTACAAGGTCGAAATCACCAGTAAGCAACTGGTCGTCGTGCGACGAAGCCTATGGTCTTATTT
CTCGAAGTATGAGAAGCGCTTCAAGGGTAAGAACGCGTTCTACATCAAGCAGCTGCTGTCGATCTTGGAGTGCTTGACGAAATTCCTTCGGCAACTGAGC
AAGTCTGCTGGAAAATCCTCATCGACAGGTGACGAAGACGATGGCGCCCCAGGAGCACAGATGCTGACAATCAATGATTTCTTGTTCAGTGCTCGGATAG
ACCACTTCAATATGTTCAAGATTCTGGAATATCTAAGGGAAAGCGGTCTGGCAAAGAAGTTGATGGGGTTCGTCGAGTCAGCAAACGCTGGCGCTCCTGC
AGAGGCACCGCCGCCACAATCTGTTTTAGACGATACAGACGAAGGCTTCCAGAGCCGGCATATCTCGCCACTCCGAACTGTTGAGGCTTTGCTAAAGGCC
TTGACCAGCGTAGGCGGCGATGGCCGTATTCTCGCACAACCGCATAATGTAAGCTCTGAAGCCCTGTTTCGACGTCGATAACGTGATTCCTAACTATTGT
TTCTGTGCCCAGGCGAGCAAAGGTGTTGAAGGTTTGATAAGGTTCATTTTGCTCAATCCGGTCATACATTTCCAAGAAATCGTGAGAAAGGCACGGAGCG
TCATCCTCGCCGGAGGAACAATGCAGCCGGTGAGCAATAAGTATTCAAATTTGCAACCCTGTATATAACTAACATTTAGCTGCACGGTAGGTGTCTCAAA
TGATCGACCAACTATTATCTTCCGTCCCAAAAGAAGACGTTGATTTGTTCTCCTGTGGACACGTGATTCCCCCCGAAAATCTGCTTGGATTCAGCCTTAC
GTCGGGTCCTTCACAGAAGCACCTCGAATTTACGTACTCTCGGCGAGGCGATATGGAAGCGCTGGACGAGCTAGGGCGCATCCTACTGAACCTTTCACGC
ATTGTTCCAGGTGGGGTGGTTGTATTTTTTCCTTCTTACCGGTTTGAAGAGAATGCAGTGCATCGATGGAAAGCCACAAACCAGTACGAGCAGATTCAAG
CAAAGAAGACCGTTTTCAGCGAGCCGAAGAAGTCCGATGAACTCGCAAATGTGCTAATGCAGTATTCTGCAGCGTGCTCTCAAAGTAACCGTGACGGAAG
TGGTGCGATGCTGTTGAGTGTGGTTGGCGGCAAAATGTCAGAGGGAATCAATTTCAGTGACGAGTTAGCTCGATGCGTTGTGATGGTGGGGATGCCCTAT
CCAAATGCCCGAGATGCAGAGCTCGTCGAGAAAATGGCTTTCCTAGACAAGAAACACCCGGGATCAGGGCGACAGTTCTACGAGAGTCTGTGCATGAAAG
CGGTCAACCAGTCAATTGGTACGTGCGATTCTGGTATGCTTCTGCCCCTTCCTCCCTCTAATCCGTGTTCTCTTCGCAAACTTTTCAAACACAACAGGAA
GGTCTATCCGCCATCAAAATGACTACTCCACGATTCTGCTAGTTGACCATCGATACGCAAGCCCAGCCGTCCGCAGCCGCCTGCCAGAGTGGATTCAAAA
GCGCGTTCAACCTCCATCATCAGCCAAGTCGTTTGGACAGGTGTACTCGCAACTCGTGCAATTCTATCGAGCGAAGGAAAGCCAGGATCGTCGACCGGTC
GATAAATAACACGAAGTCTTCACCACCCAAATTCCTATTGAATTCCTTACAATAGATCTGCAGCAATAGGTAACGTTGTGATGAAAAGAAATACTTCGAC
GAGGGTGCCCGAGAGTGTATGTGACGGCATATCATACAGACGTCAGCTTGAAGATCATCCTTTATCATTGGGATAAGCTACTTTGCTAGCTGTTTCTTGT
ATTCAGCGTGAATGACTTGTTTCGCAATGCCCAGTACTCGACCTGCAAGAGCTTCGTCGTCGTAAGACCATTCCATGTGCACTTCCCACTCAGTAGACAC
TGACACTCCAACTGTACGAAGCTTCAGCCAACGATCAATCTTCTCAATGGCAAGATGGCGAATCCACTTGATAAGACTGGCCTCTAATGCTTTCAGAAGT
TCGCCCACATTCGCTTGAAGCTGCTCCTCATTATCATTATCTTCATCAGCTGACTCAACTGCAGCTGAAAGTAGAAAAGATAGAGCTGATGCGGGGCGGG
AGCTTTTCTTCTTCACCCGAGGCGAAGGCTCGAAGGGCTTCTTCCAGGAGTACGAGAAGAAAAGTGAGTGTTTCTTCTTTTTCAAACGCCGTGCGCCATT
GCCAGCTGACACAAGCATCAGCTTGCGCTTTGGCTCAGCAATCAACATACCCTGCACATCCGAAGGGTTGTTAAACATAGCCTTGTGAATGCGTAGCGGG
ATATCCCGGGCAGGTTCAATGGGAGTTCGCCCTGTAGGATTGACCCCTTTCACAGTCACGCTGGTGTCGACAGTTGGGTCCATCTTCATCTGGTTCTGGA
CGTGTGTCTGGACAAATGCCAGGTCGTCTGGGACCGTATAATCGAGAATGACCTGGCGTGGCGCTACGCGTGATACAAGCTGGACAATGCTCTTAGTGTC
CACTTCATCTCCACAAGGTTGGTAGTGTACCCCACATTCCACGTTCACACCTAAGCGCTTGCTAACGCGCTTACGCTCAGGGTCTGCGTAGAGCAAATAG
TTTACTGTGCCCGGTGTGCAATACTCTGATAACACGATGAGATTCTTTGGGTCACTCGCAACCGCCTTAATCGCACGTAACGAGTCACCCTGAGAAATGT
TGGCTGGTCCTGTAAACAGCACGAACGGTCCAGGTTGCTGCAGCCGCTTCCAATCGAACACCTGCAGGTCAGCAGCGTTTGGAGACCTTTCACGCAGCAA
ATTTTGCACCGCATGCGTGCACGTGCGCGACAACAGCGGCAAGAACCGGCTTGGATACTCCATGGCCGAGTCCGACAGGTAGATCGGACACTGCGCCGAT
TTCCCGGTAGCATCCTTCATCTGTTGCCAGTGCTCCAGCAGAATCGTAATCAACTCATGGAAGTACCCGAGACGGTATACAGGAATCACCACTTTGCCGT
TCGAGCTGATACATTCCAGAATGACTTTCACAAGCTCCCTTTCCATGGCGCTCTGCGTCTCCGATACAGTCACGGCAAAGGAACTGCGCGTAATCAGCGC
ACTCGGTTCCAATCGTGGAATCTGCGCCGGCAGCAGCACTCGGCCACCCGTAAGGTTAAAGTCGTTTGCAAACAACACCGTCGTCGTCCCGATCTCCAAG
TAAAAAGCACACCCGCCCGCCACATGACCGGAATGGTAAGCTGTTACCTTGAGGTTCTCGTTCACAGTAACACAGGCCTTCAACGCAACAGCTTTGGCTT
TCCTGAACGCCGCAGCAATATCCTGAATGTCGTACGGAGCTGGCAGGCCGCTGCCTCCGTCTTTCGCCTTGCCGTGGCACCCAGTCCTACAGCACCAAAT
TGTCAGCACTTTCATAAAATACAGATATTATCTGTCTACAATTTCCTATCCCTCACCAGTATTCAGCCAGCAGATGCGGCGCGATGGCCCGCGTGCCGTG
CGTCATGAGGACCGCTGGAGGCTGTTTCTGGCTCGGATCTTGCGCTGCAGCGGCCGTTGCAGTCGCCCACGACACACCGCACTTCTCGGCTACATAGGGC
AGCATGTAACACGCTCCGGGGCGGTAATCCGGCACCAGAATGGCATCTAAAATGCCGCCATCGCGTTTCAGGAGGTCCTTTAGCTCGCGCCGGTACTGCG
TTGTCACCGCCTCAAAGTCCTCGGCGCCCGCATCGTCGCCAGAGAAGAAGGACACGTCTTTCGCCTCCCCGCAGCCCAGGAGCACCGTCGTGCTCGAGAG
CTCGTCGCGCAGGCAAAAAGCCGCGCCATTCCCAAGCCTCTCCACTGAAAAGCTCATGGTTTTGTTGTACTATGAGAGGGGGCGAATGACCAGATCAGAA
TCTGATAGAGTCTGAGGAATCTGAGTATGTTTTTGTGGGTGTCCTTGTAGACTCAAATTGGTCCTCCGTGACCCGTACAACATTTTTTCAGTCTAACCAT
GTATGCGTATCTATCCCTTGTGGTCCTTCGAGCCTGTACAAGCAGCAAGTGGATGCTACGTCCTGCATCTAGAACTTGCCAGCTTGAATAAGTCCGTCAA
AATAAGCTGGCAGTTTGTCCAGTGGCAGGAACGTTTTCTCCATCGTTGCTCGTGTCTGTACCTCAACGAGGCCTTCCTTCACGAAGCGCTTGCCAACTAC
GACACGATACGGGTACCCGATAAGCTCGGACTCGGCAAGCTTAGAACCCGGGCTTTCACGCCAGCGGTCATCCAGCAACACGTCGTCCCTGACCAGGCCG
GTCACCTTGCCAGAAGCTAGTTGGTCAGCGATATCCCATGCAGCCTGGGACACGGGGTCTTCCTGCTTCTTCCCACCGATGGACATGACGAGGATCTTGA
ACGGAGCGATCTCGGTGGGCCACGCGATGCCGCGGTCATCGTGGGAGGCCTCCACTGCTGCGGCCACAAGCCGGCTAACACCAAGGCCGTAGCAACCCAT
CTCTAGCGGGTGCTTCTTGTTCTTGGCGTCTGTGTACGTCGCTCCGAATGGTTTCGAGTACTTTTGGCCCAGGTAGAAAACGTGGCCTACCTCGATACCG
CGCTTGTCCTCGAGCACTGCAGCGTCGCCGCCATTGCAGCGCGGGCAGTGGTCACCCGCCTGAGCCAAGCGAAATTGGCCCCACACAGCGTGGGTACGCG
TCTGTTGCTGTGGCAGGGCCTCGACAGCCGCACAAAGAGCTTTCACGGCACGGGTAGCGTGCTCATTATGCTTCAGTGAATCATCCAGAAGCACATGCAG
CTCCACAGAGGGAAAATGCCCGCCCAGTAGCTCAGCGATCTTCCTTGTGTCCTTGATCACTTCGCCTTCGTCACCACCAATAAACGGCTTGATTGCAAGC
TCATTTACCTCCCTGTCGTGTCGAGCAAAGCAAAGAGCCCACCGGGGAAGAGACTTATCTTCCTCCTCGTCGTCGAAAGCCTCAGAGTCACAGCTCTCCA
CCTGCTCCTGAACCAGCTTAACCGAAAACCCGTGGTCCTCTGCTGCCTCCTGAAGGTCCATCACAGTCTTCCAGACCTTCTCGTCTCCAGTTCGAGCCTG
TTCCTCGAGCTGCGCAATGATGGCGCCAAGCTCTGTCGAGATCCCGCCATTTACCGTCTGCTCCGAAGATGGCAAAAGCCCCTGCGCTTTCTCCACATTC
GCCGCATAGTCACACTCTGCCGACGAACACGACAGAATCGCGTCTTCGCCGATATCAGCCAGCACGTGGAACTCGTGTGAGAGATTGCCACCGATATTCC
CCGAGTCGGCCTCCACGCGCTTGACCGGCAGCTTGAGTCTCGAGACCAAGATCTGGTTGTACGCCGCAGTGACGTCCTGGTACGTCTGCAACGCACCGTC
GTACGAGGCGTCAAAGGAGTACATGTCCTTCATCACAAACTCTCTCGCTCTCAACAGACCAAATCTCGGTCGAATTTCGTCGCGAAACTTGCGGCCGATC
TGGTACAGTCGGAGCGACGCGTCTACAGCGCCCGCAGCTGAGTAATGCGCTGCCACGAGGCTCGTGACGCTCTCCTCGTGAGTGGGTCCGAGCACCAACA
CGTCTTCTCGGCGGTCCTCGAGCGCCATGAGCTCCGGGCCGCGGCTCTGCCAGCGCCCCGACTGCTTCCATAGCTCGTGAGGCGTTAGCACAGCCAGGTC
CACGCGGTTGCCACCAATTTTGTGCATCTCGTCATCGATGAGCGCCTCCAGTTTGGCTACAACAAGGCGGCCGAGCGGCAGCAGCGCGAAGAGGCCGTGG
CCGCTTTTGCGCACGAAGCCGCCGCGCACCAGCAGCTGGTGGCTGGGAACCGCTGCGTCTGACGGCGCCTCCTTCTCCGTGGGCGCCCACAACACAGAAC
GCAAGGCGCAGGGGGCGGCGCGTACCGCCTGGGACGACGACAGGCGCCGCTCGGCCGTCGCCAAGGACCTACGGCGAGCAGCCCACATGAGCAGCGATTT
GAGCCGCAAAAAAGGCAAGTATCTCTGGTGTGTGGCGTACACCACATTATTTTACGACATGGCTTCGTTTTTCTCTGCAATGGACTCCCTTCAACAAGTA
AAAAATTGGCATGGGATACTGTCGGAAGCCCCGCAAGATGATGAAGGAAGCAAATTTACCCCTGGACAGCGGAGTCGGTCGAGTTCGTCTTGTTCGCTGC
AAATGCTGGGCTGACTCATCAGCTGGGGAGAATAGTTGTTGCTGGTACAGTCGAGCGCCGGAACCTGTCCGACTTGGCCAACCCCGCAGTCGCCTATTCG
TGTTCCGTCACTTGTCGTCGCCACGTCCGTTTGCACGCAGTGTCGGGCTCTCGTCATGTGCGGCGTCGACACTCGCACGGTTTCAGGGCGTTATTGCCAA
CAAGTCCATTGCCGAGGACAGGTTGCACTCAGGATAGGTACACTTGCCCCACAGCAACAGCTCCAACTCGCACGCAACGCATCCAAAGTCCAACGCAAGA
GAAAAAGTGTAGGCTGGATATTGTGGTCCGTAATATCATGTGCATCTCCGCATACACCGCCACATCCGACCCCGTCTCCGTCCCATAATACCCTATGCCA
ATTAAACCGGCTGGCGACCTTGACGTTGTCCGAAAAATACAAGCAGGTGCCAAGTCCCAGTTTAGTTTCTGCCGCCTCGATCGATGGCTTCAGCTTGGCG
CCAGCATCCGCACGATCCGTGGGACCTGCCGTCGCCGCCGCCGCTACTAGAAGAAGCCGCGCCCAAAGCTTCCAAGCGCTCACACTTTTCACGCCGCAGC
ACGCGCGCCCAGAGCCAAGCGAGAGCCCAAGCGCAGCAGGCGGAGCTCGAGGTGGAGGCGCTCGCCGACCAGCGCGACCGCGACGAGCGCCGCAGCCTCC
TGGCCGCCATGTTCGGTGGTCGCAGCAAGTCACGCACGTCGCGATCGTCCTCGGACGCCCCGCAGACGCTCGTGCAGCGAGAAAAGGCCTTCCGCCTCGT
GCGCCACGGCTCGGACCCGCTGCTGAACGACGCGTTCTACGCCACGCAGGTGCAGGTAGGCAACTTCGTCAAGATGGGCTGGCTCACCAAGCAGGGCCAC
ATGTGGAAGAGCTGGAAGACGCGCTTTTTTGTGCTCTTCTCGGACGGAACGTTCGCCTACTACAAGAACAAGGGCCGCAAGAAAATCAAGGGCTGCATGC
AGCTCAATGACGGCGTCGTGTCCGTGCAACACGTGGACGTCCGCGTGGCGGACAAGGCCTACGTATTCCAGATAGAGAAGGGGTTTTACAAGCTGCTGTG
TTATTGCTGCAGCCAGTTTGAGGCCGAGCTGTGGGTCGCAGCGCTGCGCTCGGTGCGGAGAGTGACCCCGCCCTGTTACGAGACGGATCTAACGGCCACT
GAGGAGAAGGCGGGCTCCAACGCGGTCACGAGACACTTGAACAAGATTTTCATCACAGATAAGCAGATCGCCAAGAGTTTGGTGCAGTTCAAGGTGAACG
AGCACGACCATTCGTACGCAGCAATTCACAATTTTATTGTCGAGCTGGACGACGCGATCATTGATGGTCATCATTTGGAGCTCTATCAGGACCCAGAGAT
TGAGCTGCTGCCTGGTAATGACCTGGTACGGCTGATTCGTCGACATGTGGAAGATCGAGTGTTTATTCCGTTGTATGCGGAGGCGTACGCGAGCTTGGAG
ACGGACAAGGTCAAGACGAGGCGCAGCAACCTCGAGCAGAACCTCAAGGTGCTGAGGCGGAAAACTCAGGCAGATTTTGGCATCTCGAAGGATTTATCCG
TTTGCGACTGGAAGCTAGCCATCAATGTGATTAACATGCTCGAATGCGTGTCGCTCCCAACGCACAAGTTCGAGGTCATTTTATCAGCTGGAAAGGCCAT
CACGGAGTCTATTGCTCAATATAACGGCGACCTGTTCGAGGTATCAGATGAGACGCTGACGGCGGTTTTTCGGTACGTAGTTACAATGGCGTCACTGAGC
GATTTACCGATTCTGCGAGCGCTTCTCAAGTACGGATACCAGCACCACCCAGCGTGTCAGAACAAAGCAAACGTCGTTTCAGCTTTCCTCGATGGGATCA
AATGGGTGGAGTGCTTCGAGACTGGCGATGAAAGCTATCAGTTTGATTCCTTAGCGCTAGCAGGGTCTCGCGTGTCGGTATCCATCTCGACTAACGATGT
CGGCATTCAGTTTACGACCGATGGCAATGGTAGAGGGGCTATTGTTTACAGTGTGCGAAAGCAATCACAAGCAGCACTTAGCGCTTCAATCGTCCCTGGA
TTGTCGCTGATTGCCATCAACCACGAACCAGTTATCGGGATGCCTTTCGACAAGATTATCCAGCGCGTGCGAACTGCGGCACTCCCTAAGCAACTCATTT
TCATGACCGAGTTTTACTACTACCAGCTTCTTTCGCTGGATTCGGAGATGTTTCGATACCTAATGTGTATTGCAGCGCGCCGTGGGGACTTGGATTCGGC
TGCTTGGCTGCGGTCGTCCACGGTGGAGCTCAATAAACTTTGCTCGTGGGAAAAATCTCGAGGAAAACAGGTCTTTGGATTCATCCCTGTATCTGGGAAG
GGATCCCCACTTCACGCGGCAGTGCATAACGGTCAACTCTCTATGGTGAAGTATCTTATCTCAAGAGGGGCTGATACGAACTTGTGCAATCAGAAAGGAA
GACGCCCACTTCATGTCGTGAAGCAGTCGATTGATATGGCGTTGATCATTGAGAGCCTTATTGATGCGGGAGCTGACATTGACGTAGCGGAAAAACACGG
TCTTACCCCGCTAATGTTCATGTGCTTTAGAGCATCGCTTGAAGGTGCCGCGACGCTTGTAGCACTTGGAGCAGATGTTCGCCGTGTTGCATGGTCGAAT
GGATTTTCGGCTCTGGAGTTTGCAGTGAAGAGTGAACGAACAGAGCTGGTAGAGTTGTGCCTTTCAAAGGGGGCAAATCCAAATATGCCTACGCTGGACG
GAAACACAAGTTTGCATATGGCAGCCGCTCTCCCCCACGCTGATATAATCCTCCGGCTCCTACAGAGCGGTGCAAACCCCAATGTTCAGAATCGGTATGG
TCAGACTCCGGCCACAGTCCTACTTGCGTCTGCTCCTGGTGGAGGTGGCGATGCCCGAATCCTGTGTCTGGAGATTTTAACATGTGCCGGTTGCCGGTTG
GACAAACGTGATCTCTTTGGTCGCCAGGCTTCTCACCTGGCAAACATCTCGCGAGATTCTCATGTCATGGGTCTACTTCGAAAGTTGGGATCGTTGAACC
GAGCAGGCAATAGCGTTGATGTCGATATCTTCGGTTGCTCACCTGTTGATTATAGTCATGGGATCGAGGTAAGCAAGGCGACAGAATATTTTGGATCGCA
AATGCCGAACAATTCGTGGGAAATCATTGACAAGACCGACCACGTGTCTCGATCTGCACTCTCGGGTTCTGTCGAGGATTTGATTCGCAAGTTAGTTGCA
GGCACGGAAGTGGACTTGGTGGATGTGGTGGCGTTCGTGCTCTTCTTGGACAGCTTCTCGAGTCTTAACGAATTGGTGGATCGGTTGAGCGAGCATGTCC
GAAACGGGATTAAAAGTAAGTTTTGTGCGTGCTTGTTTGTTAATCCTTCGCGCGGTCAATATGCACCTACATTAGACACTAACGTGGCATTTACCCATTT
GTATTGTTCGTATAGGCCACGGACTTATCCGTCTCTTCATCATGATCCTGCTTTTTAGAAATACGGAAACGAAGGAAGTAGATGATCTGTCTGATCGCTT
CTACAGCCTGATCAGTCACAACATTGACGTCCCTAGGGAAAAGTTGGTACCTCTTGTTGATGAGTATACCTCCCTTTATAGGGAATATTTCTCATTGCGA
GGAGCTGGAAACTACGCCACAACTTACGAAAGGATTCCAGAAATGATGACTAAGATATACGGCTTGGAGTCAGGCATTGAGTTCGTATCCGACGAGCCCT
TTCCGCTTCATTTGCACCGGTAAGTCGAGTGATAGCTCATTGTCTCCCTTTTGATCGAACATATCTGACCTATGGATTTCGGTCCTCTTTCGTTGGGTAA
TATCTCAGGTATATTGATGCAGAACGGTGGGCTGAACAGTGCACGCTTCTGACGCACGCAGTCTTTTGCCAGATTCCAGGTGGGATGTTATCGTCTGCTT
GTTTAGTTGGAGGGTTGACTAAACTTTGCTGTCTCTAAAATGCAGTCCAAGATTTGATTTTGACAGGCTCGAAAAAGCAGCACTCCGTTGAATTTACGAG
TATCAAACGATGGTTTCAGCACGTACGTTCTGTTGTCGCTTTATATTTACGTGCTAAAGAGATTAACTTTCGGGCGTTTTTGTCCGTGGTAATATTGTGT
AGATCTCTGCGTACGTGATCAACGCTGTTCTTGTACAAAACTCCCCAGAAGAGCGTGCCGAAGTAATTTCGTTTTATCTCAAGGTAAAAGGATATTTCGG
CTCGTTTGACCTCTGGTGGGCTGCATGCTAACCTTTGATTTCGAACTATGATCAGGCCGCCGATTATTGCGTGTCATTACACAATCATGATACGCTGGCT
TCGATCTTATACGCATTGCAATCTACTGCGGTACAACGGCTTAGAAAGTCGATCGATTGTGTACGTTATTACCAGCTATGTTCCTCTCGTGGGCACGAAG
TCACGAATTCTGATTTGGTGGTGCATTACAGCTAAGTGCGGAAGCGAAGAAGATGATGAACGAAATGCAGCTACTTTCCGACAAAGGATGTCGCGAGATG
AACCGGTTGATGCGCAAAACTGTCAACCCCAGTATGCCTTATATTGGGTTGTATCTCCAGGTAAAGACGCGCATTTCAAAGTGATGCCTTCGGACGAAAA
TGTCTGACATTGTGCGTGTTGATTTAGGGCTTCGTCGGACTGAACGAGTTGCCTGCGTTTGGCAAAGAGGGTCAAGTCAATGCGAGTCGGCTACGAAAAA
TGGGCGAGTTGGCAATGGAAATCTTGCACCGCCAGTCTGTTGCGTACACTCTTCAAAACGACGAGAGTATTGATGTGAGTAGCAATTTTGCCTGTCGTCG
TAATCCTCAGCTGTGGATATCACGTCTAACCTGCGTATGTAACTCTTTTGCAGAAACTGTTGCACGTTTCAATGCCGTATTCGTCGGAGGAGAGTCGATA
TGCTCGGTCATTGGAGGTCGAGCCGCGTGAAGCAGATGCGATTCCATTGAGCGATCGCGGTTCGTGTGTTGTTGTTGATGACGACCTCGACCTTGAAAAT
GAAGTTCGCGAGTCAGTTGGCGGCGATGGAACCTTTGGATTCCGCCAGTGGATTAGGAAGCAGCAAGTCGTGCACCGCAATCGCTCACGCTCTTCGCTGA
TAGCTTTGTACGAGTGGGTGTAGCTGTGATGTGCTGTCTTCTGCGCCGTGCTTTGGTGAATACTTTTATCTATTCGTTGTGGAATGTTTTCGCCCAACAT
TAATACATTAGCATATTTAGTTATCAGCGATGTACTTCTCGAAGTCTTCCATCGACATCATGGCGTCCGGATCCAGCGATAGTTCAGCGGGGTCCTTTTA
TCAGCAAATGGCGCTCATTAAGTTAACCACTTGTGCGCAGTTGTCATCCACATGACCAACGTACCTGCTTGTCCTTGTCCTGCTTGTGCTCGTCAGCACC
GAAAAGATCGTTTTGCGACTTTAACACTGGTGACGGCGGATCATCCGTCGTCAGGTCTTCCATCTGCTGCATGATTTGATCTCCCTTTTCCCCAAGCATG
TAGTCATCTCTTCAGACGCGAACATCACCATGTTAGTGCCGCTGTTCAATGTCGCTTCTTGTATGCCTCGACGTACAGGAGGCGATTCAGCTGGATATCG
CTGGCTGCAGGAACGGTACCATCCGACTCGGGTTGAGACTTCTAATAGTACGACAATCTCCACAAACTAAGGCCAAAGTACCAATGCTCGTCAATTGTAG
CTAATATTGCTGCCCACCTCCGTCTTGGAGAAGAGGTCGTGTGGCTCTCGGCGCATCTGCGGACGCTTCGTCTTGCTGTCCTTTGTAATATTCTGCCAGT
GGTGGATCTTGGTCACAATGTCTCTGACGACACATTCTCCGTCAATGCAATTAGCACTTGCGAGAGTGATAAACTGCGTCGCCTACTCGTCTTCCTCTTC
GTCGGCGAAGAATCCACCTCCGTTGTGGGAATTCGCTTGGTCCCCACAGCGCGCCACCTTCTTTGATTCGTTCGCAGGGGCAACGTAGCCATCCGTATGC
GCCGCATCAAAAAAGGAAAATGCTACGATGAAGGCACGTAAATTCACAATAAAATAGTTTGGTCATCTTGTCAGTGCAAGCATTTCGACGCCCTTACTAA
ATCTCGTCTTGTGCTCCGCCATCTTCGTGGTCAAAGCTTCTGGAAAAGATCCAATTGTAGAGTGGTACACGGTACCGGTGTTGAAGCTTGAGCACGGTAA
CTTCGAACTTACTTGCGCGCCGAGCACTGCCCATGGAGGTCTATCCACTGGGTAGACCTCTATATAGCCAAGTAGACTTTACTGTCATGCAGAAGTACGC
TAAAGTGTAGCGGCTAAACTAATGAGAGCTAGCGTTGGTGAGCGATTTGGATGCTCGTGGAAGGGTTGGAACAAAATGTCGGCTGGATTACAACGTGTAC
AATAGATTACAGGCCGCGCACATCCAACACGCCTCTCTTGAATCGCCCCTTGGTAGCCTGCACGCCATAGTCGACCTTCTTTCGCTTTTGGTGGTCTCTC
GAGTCGCCGCTCGATTTCCGCTTCCCTGTCACCACGTCCGACTCCTTCAACTGAGTGGTCGTACAGCGAAAGCAACAGCAATAGTAGCAAGAGTGAACAT
GCTACAACCGACAACAATCACAAAACACCTCAACCACAAGGCGTACCAGCTCCTCGCGACGTTGCTTGCGAGCCACGCCCTTCGTCTTCAATCCGATAAG
CACCTTGTAGGGCACGCTGCGGTTCTTCGCCGCTTTGCCACCCAATGCCTCGATTTTCTTGGCCTCGTGCGCCTTCTTCTCTTTTCCCTTTAAGCTTGAG
CTGGCTGCCACCGTCAACGCCAGGCACCAAAATCGAAATTCCGTAAGTGGCTCTAATCCCATTGTTCTAAGCTCTGAAAGCTGCAAGACAGTAACGCACC
GAACTCCAGCACCAAGTCGAACGTGTCATCGAACTCCTTGCGGATCTCCTGGCGCAATGACAACTCAGGTTCCTCTTCTTTGGCTTTGCTCTGCGGCAAA
GGAGAGTGTCAAAGTCGAATCCATATCGAAACAACCGATTCAAGCACGAACCTTGTTCACGCGGGGCTTGCGCTCCTTCCACGTCTCGGTGGGGCACTCG
AACACCTGCACTTTCTTCTTCTTACCGCTCGCCACGGGGAACTGGAACGCCATCTTCGACTCTGGTGATGGTCGACGCCAACCAAATGCTAGCGCTAAAC
TAACTGCTATAAATGTGGACCACATAAACATCAAACCCGTGACGCGCGCAACAGATCGATACTATTTTGCTCGAGAAATGCACTATTGTTACTACAGGTT
CGTCGCTACAGTTCAGACCAGAACTTGCACCTGGAACAGACCACTGCTGGCTGCTACACGCTCGTCGCCGTTATGACTGTCCAGCTCGTCCAACTCGTCT
TCAGCGTCACTTTCACCTCCTTCGCCGTAGAAGCTGCTTCCGAGGTCCGAGCCAAAACTGTCCCGTCCGCTGACCGATTCACTCGCGAACGAATCCACCT
TGTTATCGCTCTTTGTTTCCTGCTCAAAGTCATAGAAGCCGCGGCTTTTGATGACGCGGCTGCTTCGTAGAGGATTCGCACGGCGGTTGTCGTTATCACC
ACGTCTGTCCGCTGCGGTCGGAGAGGCAGTAGCGCGCGGTGCTGGTCCGTTATTGTTTTGATTTTGCGACTTAGGGCTCAAGGGAACGAAGACGCTTTCA
CCAACCAAAGACTGGTTTAGCACACTTTCGTCGCACGCTGGGACTGCAGGAATCGGCCGATATCGGGACAATCGCTGAAAGCGAGGAGACTCCATAGCAT
TGACTGTCATACGTTTGTCCGGTGTTGGCGCTGAAAAGTCGGCCATGGACATCGGACTTGGTGGCTTTCTTCGTCGCCCTTGCACTGCGGGGTGAGCTTG
GTCGTCCTGAATATTCAATTCTCCTAGGGTCTCGCGAAGCTGATTCAACCGTGAGAACGTCTGCGCTTCGGGAACATCGGCTGACCGATCCGGAAGTGCA
ATACCACCACGCGCAATATTCGATTCAAATCCGACAGACTGAACTGGTGCCAGTCGATGCTGATACGAAACAGCCTGGTACTGATCCTGTTGCTGAGCTT
GCTGCAGGGTTTGTCGAGCCTGCTGGGTCTGGAGGTCCGTGTGGTGTTGCTCGTTAAGGGCTCGTTGTGCATCAACAAGACTAGCCATTTTCTCGTTCTC
AAGTTGCAGCAACGCCCGTTGCACACGCAGTTCTTCTTTCTCGCGTCGAACCTCATCCCGTTCTCTCCGCAGCTCCTCTCGTTCACGGCGAATTTCTACC
AGCAGCGAGCGGTACTCATCAATCATACGGCTCTGCTGCTCCAGTTGCTGGCGTGACTCCTGAGCGTCGTTCTCTTGAGGATATAAATGTCTCCCTACTA
TGCCATTGGCCGGGCTCCGATCAAAGGTGTCGCGTCCGCCATCATTCGCACTACTCCGCTCGATACCTAGTTGCATCTGAATCCGCGAAGGAGCAGGAGG
AGGCAGCAGTGTTTCTGCAGGGCCCGTGCTCCCATAATGACGGTCTCTCTGATAATATACCGCCTTGTCTTCTTCCCGTGGGTCTCTGTCGAATGCAAAA
TTGTGACGACTGCTTGCAGTCGGTTGAAAGTCGTTCCTCTGTCGATCCGTCAGATCTGGCGGTGGCGGCAACGTATGAGGGTACGGAGAGTTCATCTCTG
CCCTATTGTCGTTCAGCTCAGCATTCACCGCCGGTGAGAAATGCCCCAGTTTCCGCTGCGCTCGCAGCTGCTGCTCTCGGAGGAAGCGCATCTCTTCCCT
CGCCGCATCCTCCTCGCCGCGTCGCCGCTCCTCCTGCTGCAACTCCTTCAGCCGCGCCTTCTCCTGCACCTGTTCATCCAGCATCCTCTTCCACTGCATC
TGCTGTGCGCGTTCTCGCAGCCTCTGACTGGTCTCGCTCTCGTCTGTCACTCGGAAGCGCGGGTGGGACGACGAAACGCTGTTGGCTTCCCCCGTCGCGG
CGCCGCGGTCTTGTCGTTGCTCGTCGTGCAGTTCCACGCTCTGCGCGAACTTCCAGGGCGACTGGGAGGCCGCTGGCAGCTCGAAATGGCCGCCTTCGAC
CAGCCACTTGGCCGGCGAACGCTCGCTCGGCGCCAGCTTGCGCTCCAGCTCCTCGCGCTCCATCTGCTCCTGGTGCTGGCGTGCGCGACGCAGCGCGATC
TGGTGGTCCAGCTCCCGCGCGTAGGCCTCTCTTCGGCGCTGGATCTCGCGCGGGTCCTCGTCGTTGGCGCCCGAGTCCGCAGACCACATGAGGGCTCAGA
TTCCTCCGGCAGAAATTGTCGAACGTTTTGATTTGAAGCAGTTTTTGAGAGGGAAGGCGTTTGATTGGAGGATAATAGAAATTTGGACTGGTACAGCAAC
CTGACCAGGAACGGACCTTCCTAGAAGTTCAACGAGTTGCCAAACAGACACGAGTCGGCGTACTCGCGTCGCAGATCGACCATTAGCTTTTCCACTTGCA
AGTCGCTGCGTTGACACTCAGATTGCAGCAGTTGGAAGCGAAGTGACACGTCACTCTGGAAGCGACGCAGCCTCTTGCGCTCCTTCTTGGCCCCATCTCG
TCGAGGTCGGCGGTGGTGACTGCCGCTCCGACGTCGGTGCTGTTTGTGGCTGCTGCAGTCGCTTTCGCTGCTGCTGCCGCCCACGTCGCTGTCATAGTCC
TCACTCTCAGCTTGAGGCCCGCGCAGCATCTTCTGGATACGGACGCGCTCTTTTCTGCGGCGTTCGCACTGGTCCAGATTGCGTAGCAGCGCATCATGTT
CTCGCTGCAAGCTGTCGAGTCGGTCCTGGCCGCGCTGGAACGTCTGCTCTTCTCTGCTGAGCCACTGCTTCTTGCGCTCCACCTCCCCATACAGTTCCGT
CAGTATCTCGTGGACTTCCGCGTCGTCGGTGCCACGCGTGTTTTCGCTCTGCGTCAAGTACAGCGTCTTGTGCTGGGAACTGCCATTGCTTGTCCCTCGA
CCGCTCGATATTTGCTCCTGTGTGCGCACTCGGAACACGACAGATTTCTCTGTGGTGCGCACGACACTACGGCGGGAACATCGCTGGCTACTTTGCGTGG
GAGACCAAGCGGGGGAAGCACTGCGGCCCCGGGAGTGAGTGCTGGACGACGAGCTCGCGGTGCCGCTCATTGATCGTTGCGGTCCAAGATTTGAGTGACG
AAGTGAAAATCTCTGTTGAAACCCTTGAACAATTAATAATTTCGCTAAGTGAACAATTAGTGAATTTGTATCGGGAACAAATTCTCAAATCAGGTAGCCT
TCTGAAAACAGATATGAAGCAATGTATCGACTTTGTCAAAATTGCAGCTTTTTGCTGTGCATCGAATTGATTGTCTAGCTGTTGCAAGGCCGTTCCTGTC
TAAGCTTCTTGTGCTGCGAGTAGCGATCTTTGCTGGTCACTGCATAGTCCTCGATGAAGCAACACATTTATAGTTCGCTGTGAGGGACGGGTTTGCTGGT
GGGGATCGGCGAGATCATGGGCGAAAAGATGGGGCGAGAAGTGTGCATCAGCGCCGTCGAGTGCGCCCCGCCTGCGGAGACCTGGCGGACAGGGATCGGA
CCAAGGTCTAGACGCGTAGGCACGGCGAGCGGCTTCATATCCGTCAAACCCAGTCGTCCGTGGCTGCAAGAGTCAAGAAAAACAGGGCGAGATTAGCGTT
TCCTCCTTGTCAAGCCAACTCGGCTGAACAACGTACTCGGGTCGTCCCGCGACGTAGGCAATGCCGTCGCTCGTGACGAACAGAGTGTGAGAGCCACCAC
ATGCAGCTTGAATCACCGTTTTGCCCTTCAACACCTTCACCTGTTGAGGTAGAAACATCGAGACGTCAGCAATGATTGCAATACTCAAGCAACCAGCGCT
CCGTACCAAGTGAGGTCGCGTTCGACTCTTTGTGTCGCCAAGACCGAGTCGGCCATACTCGCCACGCCCGAAAGCATAGCAGTCTCCCGACTTGGCCACC
ACCGTAGTGTGCCAACCACCACATGACACACGCCTGTACAGTCCCGAAGAACACAACAATCGTTAGCATATTAAAATCCGCACATAGGTAAGCGACAAGA
CAAGCAGCTTACAGTGCCGGAATGGCATCGAAAAACTCGACTCGTTTGGGCGTCTGCTGATCGGACGTCTGGCCAACGCCGAGCATCCCGTAGTCCTCTT
TTCCCCAAATGTACACGTGCCCTTCCTCGGTCACAGCAGCCGAGTGGAAAGCACCGCAAGCGACTTGCACGACCTTCTCGCCGTTAAAACCTTCAAGCAA
TCGTGGTCGACTGACTCCCAGAAGCCCCTCGTCCTCCGTGTCCTTCAGCCACGCAGCCCCGATGCCCAGTTGGCCGCTATCACCTCGACCCCAGACGTAG
ACGCGCCCCAAGCTGGTCAACGCAGCCGTGTGCGTCCCGCCGCAGCTGATTTTTAGGATCTTTTCGTTTGCATTGCCTTCCGGCATCGGGCACTTGACCG
GCAGCGACTCGTGCGCCGCCTCGAACTCCTTGGGCAGACCCAACTGTCCCCAATGCGACTCGCCCCACATGTACAGCGTCCCGTCATTGGTCACAGCAGC
AGAGTGGCAGCCTCCACACGAGATATAATCCACCACGAGTCCATCCAGCTCAAAGAAAGCGATCTTCTGCGGCTCATTAATACTCTTGAGGTCTCCGTGG
CCCAGTTGACCCATCTGCACAAAGCACAAAGCGCATCCAGTGAGTACGTCGAGCAATGCGCGCAAGAGGTGGCGGGGAGCGCACCGATCCCCATCCCCAC
GAATACACAGTGCCGGCAGCCGTGAGCGCCATCGTGTGGCGGGAGCCGCAAGAGACCGCGATGATCTCCTCGCCCGCCAGACCGTCAAGCTGGTTGGGGA
AGTTGGAGGCCGACACGTCGTCGAGCGCCAGCGTCGGTCGGCGCTTGGCACCCGTGCCCAGCTGCCCGTCGTCGTTACAGCCGAACGCTATCACCGCGCA
TTGCGTGGCGCCCGTCGAGATGCTCATCGTCTTGATGCTGGTTGGCAGTCTTGTTGAATGCAAAATTGAATGCAAATGCCAGCGAAAACCTGTTCAGATC
GATTTGTATTGTTGTATTTGTTTGTATAAGTCGTATTTGTACCTAAAGATGAATACATAACACAAAACGTACATGTAACTTCAACATTGACGATCGTCCA
CGGGGACCTGTGTGGACGCTTCCGTTATAGGAGCGTACATCTGCGCCTTGAGAATGTGGACTCGAGGGCCGCGAAGTCGACCGCGCTTGCCCTCGAGCTG
GCGCTTGATCTGCGCGAAGCGAATAGCGTTCGGGTTCCGAGGCGGCATGGTACCGCTCCACGCCTTGGACTCGCCAGTACTTCTATCGTTGCTACTGCTA
CTTTTGAGTGAGTGCTGGATATGCGAGTGAGTTTCCGGTCCCAAGGCGCCTTCGTCGTCCTCGTCGATAGAGTTGATTCCGTATTTCTTGGCTGTGTTGG
TGAGCGACGGCACGAGCATGCGCGTGGTGCGGTTGATCTGGAATTGCTGCTTGTACTTAGCCATCAGGCGTTGACGGAAGGCTAAGGCCTTCGCCTGTTG
CTCACGCGCCGCCATTTCTCGGCGGTAAGCTTCACGTTGAGTCGGGTACTTGGTGCTCACCTGCAACGCTCGACAACGACGGCGACTTGCATCGCCACGC
ACTAACCGTTGAATCTTCACAGCTGGAGACTGCCGAATACTTTTCAACCATCCTTTCTGCCGCTTGTACTCGCGAAATACCACGCGCGTGGTTAGTCCTC
GCCAGTGCGCCTGGATACGGCTGACCAGGGCATGCTCGCGACGCAGAACGCGCCTCGTGATTTCCAGCACGTTGTTCTCCACCTTTATCAGTGTCGGCCT
GCCACCTGATCGACGCACATATTCTCTGTAGTTCCAGTAAAAGACGCTAAGCTCTGCTGTGTTCGTGTACCAGAAGACCGGTGGCTCGTTGGGTCGACTC
GCTAAAGCGTAACTAAGTATCTGCGGTGCCATGAAGCTGATTATCCGTAGACACCGCTCGATCACCGTTCGTCTCCGCGCCTGCATCCCCCGTACCCGGG
TTTGAATCCTTGTGGCCGCTCGATTGATCTTCCGCAGATATCGATCACGCGCTACCAGGCGACGACGGAATTCCAGGCGTCCCAGAAATCCCCTCGCGAT
ACGCTGGAGCAGTGCAGTTGCCGGGACACGTCGACGTTCGAACTCCTTGATGGCATTTCGCTCTTCCTCGATCTGTTCCTGGAAGCTCACGACCCCTGCG
CGTAGATACCGAGTGCTGCCACACCCTGGGCATTTCGGTACTTCTTCATACAGAAACGTCGTGTCTTCTCTTTCGCCCAACTGGTCTGCCTTGCGCCGTA
CTCGCAGCACGTCGATGAACGTCACGCTATTGCATCGTTGGCAGGTCAGGTACGGTGTCATGGTACTGAGCAAGTCGTCATGGCTGAGCTCCGGCTTTTG
GTCGAGAGCATTTTCGACGTTATCAGGAGTCGTGTCGACAGTCGAAGCTGCGTTTGGTGAAGGGATCTCGGCATTAGTCTGAGCGATTGAGTCGCTGCTC
GCTGTTGGATGTGGGTTGCCTGGTTGTGAAGAGTTGGGCATGGTCCTCGAGCTGCCAGCGAGCCATGGAGTCGGGTCACACTTGTGCACCCCTTCGCTAA
CCGATTTTCACGACTGGATACCAGTGGGTGCAACTGAAAATACTAAGCAAGAGTGGTTCGTGTTTCATGTGCTAAACGCAAGTTGTGCAGCCATCCAACC
TCATTCGTCGTCGGCGATGTCTTCTTCCATTTCGTCCTCAATCTCATCGTCTCCAGGACGCCCCATCTTGTCGTCGCGCGAGTTTGGACGACTCATTTGC
GCCTCACGAGAACCTGGGCGACTACTGGGAGCCTCACGCGAGGCAGGACGCGATTCTGGGCGACTGGATTTGGCATCACGCGAACCGGGTCGGTTGGACG
AAGCAGACTGCTTATAGTCACTGGGCGAGGGTCTGCGGCGTCGGTCGTCACCCAGAGAAACGCCTAACTTCGCTTGCACGGACTCCACCACCCGTGGGTC
GACGTAAGTCTTGATTGTGAGCCCCTTACGGTTCATCTCCTCCATCGTCTCAAAGCTCTTGTTCAGCTCGCCTTCTTCGTAGTACGCTTCTGTTAGCATT
GCATATGCGTCGCCCACACGGATAGCCTCCTCAATACCTGGTTCCTCCAGCAGTTTGGTGACAATGTCCATCATCTCTTTCGGGTTGTGCTTCACTTGCT
GTCGGGCGACGACGAATTGCTCGATCAGCAGAATGCGCTTCTCATAACGCTTCAGCAGTGCTTCCTTGCCGTCTGCGCGAGATTTGGACACCACCTGAAC
GGCTTCTTGCAACGCAGAAATTGCCTTCTCGTAGTCGCGATATTCCTCGATTTCCACCTGAGCACAACCGGCATAGAAGGCTGCAAGCTGCTCGAATGCA
CGTGCTTTAGTGTAGAACCCCATGATATTCTTCAGGATTTCCGGGTCCTTGCGCCAATCCAAATTCTGCAAGTAGTTCGCAGCCAGAACGAAGATTTGGG
CGTTGCGCGATACGTTAGCAAAGAACACGACCTTCTCAGTGTCGCCGGACTTGAGCAGACATTTCATGGCCTTAAGCTTGTTGCCGGCTTGAGTGTACTT
CTTCGTGGCCAAGTGATACGAGCCTTGCTGCTTGCAGCACTTGGCAAGCTTAAGCAGTAGCTCAGTGCGCTTCTTCTTGTCAGCCGGCGACGCGGTGTCA
TCACCTTTGGGAGGCGTCATCTTCTCCGCCATCTCTTCAGTAACCTTCACATCGTGTTGCATGCACACATCCAGAGCCTCTGCAACGCGATGTCCGATCA
AGCACAAGTGCACGGCCTTAGCGAAATGACCGTTGGCGATGAAGAAGTCAGCGCATTTTTTCAAGATAGCGGGCGAAGTGTTGCCAGAGCCACTGAGTTC
GTCCGTGAGGTGATGCAGCTCCTCAAAGAGTTGGGCCTGGAAACACAAATCGAGGGCCCTAGCCACGTTTCCTCCTTTGTGGTACAGCTGGACGGCTTTC
TCCATTTCATGTTGCTCTTCGAAGTATGCAGCACAATCAAGCATATCACTGGGCTTGCTCATGAGCGCGAAGCCCATGAGGTCGGCGTCCATGCGGTGCT
CCTTGGCCAGACGAATGGCATGGTTGTAGCAACCACCGCTTGCGAAGAAATGGATAGCGTTGGAAATTTCGTTGTGCGCCTCGAATTGCCGGGCCAGATG
ATACGCTGCTGCGCGATTCCCGCTCGTCTGTGCTACTTTCGCAGCCGTCTGGAAGTCTTTCTTGAAACACAAGACGCGTACAATGGACAGGTAGTCCTTG
GCACGCTGATAGCTTTCTACGGCAGCATCAAATTGTCCCTGGCTCTCTTGGAACTGAGCCCACCAAATTAGCAGGTCGCGGTTGTTTGAAGTTGCTACGT
ACTTCTGGAGTATGTCCACCTTGCCCAGCTTGAATAGCATGCGAGGAATATCCTTTTGATGAGTGCCAGCATCCTCGTAGGCTTCCATCGCCTCCTTCAG
ATCTCCCATTTCCTCGTAGTGTCGTGCCAGTGCGTGGTAAGTTGTCTTGAGATGAATGCGGTCGCGCTTGGCCGCTACATCAACAGCCTTTTTCCAGTAT
CCGCTGGCCTGATAGAGTTTGTTCAGGAGGTCGTAGCGGCCGCACTCGCGGTACAAACGGGCTGCATCGTCGCGAAGGCCTAGTTGAATTGCTACCATGG
CAATCGCAACTTCGAGCTCAGGTTCTCTCTTTGCCTCTTGCACTGCAGCCGCACCTCGAGCATGGCCCATATTCCCGAGACATACCTCAGCCACATCCAG
CCGCTTCGTCTTCACGCACATGCGCGCCATGTTCTCCCAGACGGACGGATTTTCAATGAGTTTGACTGAGCGGTACGCTTCATCCATATTACCGACCGTC
ATGAAGTAGCAAAAGTCGATTAGAGCTTGCTTCGCCTCATTGTTGACCTTATCCAGCCCCGTGAAGTCGCGCATGATCTGTGTGCGAAGATAGCTAATGG
TGTCGTAAACCATGGGAGTTTTAGTGACGGGGTTGTTAGCCTTGGTCCGGCCAACATGCACTACGGTTGTGGAGTCATCTGATGAGCTGTTGTCCACCTT
TGCCACGAAATATACACGTGGAACTTGAATACCTAGTAGCGCGGAGTACTTCAGATCAAGGTCAAAACTGTCTTGCATCAGTAGGCCGTGCTCGTTTGAC
GCAAAAATGATGGTGACCTCCTTGTCTGAGACTTGGTTCCCGCGCGCACCACCGGGACCACCAGTCCCCAAGCCGTCGTCGGTACGACCAGCAGCAGCTC
CACCCGATGTCGTCGACGCACTATCATTACCTGTCTTGACAGTCTCGCAGATAAGCAACCGTGGCTCTTGAGGATCGAAGAAAGCTGAGGTCGGGTAGCG
TGAAGAGCCAAAGTCAAACTGCTGGTAAATGTTGAGATCCGTTTGAAACAGGAAAAGCTTGTTCAATGGTTCTCGCATTAGCAAAGCACCTTCAACGCGG
TCAGCAAGAATGCAGATGCGAGTGCCGTCCGAGTTGACACAGATTGCTCGCATCACAGCAGACTTGGTCTCTTCTCCAAAAGCTTCGGGGAGATTTCCCA
TGCTTCCTAAAGCTTTGGGGTCACGGCGGGATACGTCGAATACGCGCAATAGGCCCCGATCCGTACCCACAGCAAGAAACTTGTTCTGAAGTGACAGCAT
CGCCGGCCGGCCTTCGGCTTCCGTGAACGAAATGGTGTTTTTCACTACTCCTGCAAGGTTACAAACCTCGACATGATTTCCGTTTGCCCGATAAATGGAT
TCACCGCGAAGCACCATAGCACTCGAAAAACACTTGAACTGATTAGTGACTTTGGCATCTCCATCTTTCATTTCGTACACTTCTGCTTTTGATCCGTTCC
AAACAACGAGCGTTGATCCGTCGTGGGAAACACCCTTCACACATAGCGATGCTTCAAGTGTCGACTGTGTGATTGTCACACCAGACTGCGCTCCATCTTG
GAACTTCTCGATTGAGAGTGTCTTCGGTCGGATTTGAATGACTGATGTATCTCCACTAAGTGCACGCTGCATGTTGCCCTCATGTAAAATGACCACTCCT
TCGACGGTGTTGGCGTACAACGCAGGGTGGGCATTGCTCCAGCCGATACGTGTGACTGCACGACCCACTTCTGCCGTGAAGAGCAAGTCCCATCGGTACG
ACACATTTGCGGAGTCTCCAGTACCTTGCGTCGTGTCAATGAAAGACGTGGCACGCCAAAAGAAAACTGCCCCTTGAGCTGTACCCGCCACGAGAACGCG
CCTTCGCGGGGAAAAACTCAAATTGTTGACGTTGTAATTGAGTCCACTTGACTTTGGTAGACTCAATACACTGTTCTCTTCAGTACGAATGTTCCAGAAC
CGCACAAGTGGTTCGCCAGACGCAATTGCTAGTAGCCCCGGACTAGCCCACTTTGTTTCCAGCAGTGAACCTTCTCCCGCTAGACTCAGCTTGACTTTAG
TAATTGGCTTTACTGTGCCGTCCGTGACGCCCACTTGATACACGATAAGCTGCACCGCCCGTGTGATGACAATGAGGCGGCTTTGCTCCTCGAAAAACAT
CATCGACTCTATTGCGTGGTTTAGCACCTGAATGTCCGAAATGTGGCCCAAATCGTCGGCATAGTGTACAGACCCCATCTCACCACCGAAAAAGAACTGT
GGACACGCGTGCTGAGAAAAATGCTCCCTAAGCAACACAAAGACATCAAAATCGAGGCAAATTAGCGCAATAGCTAGCAGAACCATTATGGAAAGTAACA
TATACTCACATTTTGGTGTGGCTGTCCTTTGGTGGCGCTGATCGAGTGGCGAAGACACAGTGAGTGAAGCTACCTTGACGCGCATATTGCGTACTGAGGG
TTAGCTGGCACCGACTATCCACCTTCCACACGGCAAATATTCCGTTCTCATCCGCAGACATGAGTCGATTCCCTGACGGGGACCACTTCAACAGACACAC
GCGGCTCGTGTGCGGCGAGTTCACTTCGCGCGCCGACTGTTCCTTGAATACCCACAGCGAGACCATACCTGGCCCGCACAAGCCAACAAGACTCAGTGCG
CGTTGATAGTATTAATTCAAAGGCATCCAACATACCGTCGCTCCATCCGACCGCGACAGCTCCGCCACGAGGCTGCCAGGCCATCGAGACGATGTCGGCA
CTGCGCGAATAGCTCTCCAGACCTTGCTGCTTCTCACCCTACATCGAGTAAGGGCCCATGCAACCGGTTAATGCTTCGGATCTATTGGTTACCCACCAAA
CTATTTGCTGCCAGTACCTCATCCGTGAAGAAGTGAATCTCTCGGTTCTCCAGCGCCACGGCCAGCACCGGGTCCAGCTCTCCCCAGACCGAGCAGACCT
GTCGCAAATTCGCCGGCACCTGCACATTGTAGTCGTAAAACAATGCCATCGTGCACTCTCTCGCCTTGCCGCCACTAGATCTTCGAGTGCATTGCTCGCG
TCGCTTCAAGATACAATATGCATTTGCATAGGTATGCTTCAACATGGTTCATTATGTAGTCCACATTACGTGGTGTCTACACACACCACATTTGATCGAA
GTTTGACTGGTTGGGCGGCCACTGGTCGTGAAAGGCTGCGGGGCATTGCTGCATACTCAGGGACTATGGCGGTGCAAGCGAAAACGTCGGAGCCCAAGGG
CAAGAGCTTCACCAAGGCCAAGAGCTTCACCAAGGCCAAGAGCTTCACCAAGGGCTTCAGTGGCAAGAAGCGCCCGGCCGGTGGCAATGGCGAGGACGGC
AAGAAGTCGTTCATGGACCAGAAGCTGGCCAAGAAGCAGCGCAAGATGCAGCGCCCGCACTACGAGATGGTGACGCGCGCCAAGCAGATCTGGAACGTCA
TCCGCGAGCGCGACGTGGAGAAGAGCAAGCGTGCTACGCTTGTGGATGAACTGTACACGCTGGTGAAGGGCAAGATCTATGACGTGGCGGCGAAGCACGA
CGCCTCGCGCGTCATCCAGTCGCTCATGCAGTACGGCAAGCCCGAGCACCGGTCGCAAATTGTGCTCGAGATGAAGGAGCACCTGATTGAGGTGGCCAAG
ATGCAGTACGGATGCTTCCTCGTGCAGAAGATGATCCGCTACGGCAGCGTGTCCGACCGCGCCGCCATCGTCAAGTGCCTCTCAGGCCACGTTGTGCAGG
TGGGCACGCACAACATTGCGGCTAATGTGCTCGAGTATGCACAGGAGTATCTCAAGCCGTCGCAACTTACGGCGCTCAAGCTCGAGTTCTACGGGCGCGA
GTTCGCCTACTTCCACGAGGAGAGCAAACGCAACCTGGCTGACATCATCGCGGCGCACCCGGACAAGAAGGCGGACGTGCTCAAGCATCTGAGCACCATT
CTCAACCGCATGGTCGACAAGCAGCTTCTTGGTTTGGCCTTCGTGCAGTCCCTGCTGTGGGAATATCTGTGCAATGCTGAGCACGACGACGTGATGCAAA
TGGTGGCGAACGTGCGTGACGCTTCGTTGGCTCTGCTGGCTACGCGCAACGGTGCTCGTGTAGTGAACAAGTGCCTGTCGCTTGGTGCGGCCAAGGACCG
TAAACGCATTATTAAGGCTCTCAAGGACAAGGTGCTGGAGGCTTGCAACCACCCCAGCGGTTACCTTGTGATCATGCGCATCCTGGATGTCGTTGATGAC
TCGGTTCTTGTGCAGAAGTCCGTTCTGGCGGAGATGAACGACGAACTCTTTTCGGTGGCGATGCACCCGAGCGGACGCAAGGTTCTACTCCAGCTGCTCA
GCCCGTCGAACAAGAAGTACCTTTCGCCGGATGATCTTGCCCTGTTGGAGCCTCCCATGCTTCCGTCGCCTGAGGACCCGAAGGTCTTGGTGGTGAACTA
CAAGAAGGACCCGGACGCTCGTCGCGAGGAACTCCTGAAGGGTCTCCTGCCCAAACTGGAGGAGATGTGCGTGGAGAATGCCACTGCCCTGATGCGCTCG
AAGGAGGGTCGTGACGTGATTGTTGAAGTTGCGAAGCGAAGTCAGAGCTCTGATCTGGCGGACAGTGTGGCGGCCGCCGCGTTGGCGGAGCCTATCGAGG
AGGAGGAGGCGCTTCACACTGATGCTAAT