Description :
From Genome Similarity Track
Location :
contig_38:394053- 431320
Transcript NameFunction/comments
g7139.t1hypothetical protein PHYSODRAFT_466952
g7140.t1anaphase-promoting complex subunit, putative
g7141.t1conserved hypothetical protein
g7142.t1ATP-dependent RNA helicase, putative
g7143.t1hypothetical protein PHYSODRAFT_467769
g7144.t1conserved hypothetical protein
g7145.t1hypothetical protein PHYSODRAFT_467909
g7146.t1hypothetical protein PHYSODRAFT_293759
g7147.t1hypothetical protein PHYSODRAFT_321830
g7148.t1conserved hypothetical protein

Sequence
37267 bases(100 bases per row)
TGGGCTTGGTCTCTGGGGCGGGAGGCCCTTCCTGTGCTTGCTCACGACCTGCTGGCGCTTGTTGCGGTTGTTTTGGGCGACCTAGCTGCAGCTTTTTCTG
CTGTTGCTGCTGTTGGATTTGCTTCTTGGTGGGGGCGTTGCCCATCTTCTTCTTGCCGACCGCTACACGCAGAACCGGTTGCGTCTTCTTCCGCTGCTGC
TGCATCTTAACGACCGTGACCTGGTGCTGCTGCTTTTTCGGCTGCGGCGCCGTCTCCTCCGCCAGGTGCGTGAAGCGACTGGACAGCGGGACGGCTGACA
CGCCGATCACGCCGCGAGGGCCCTTCTTGCCCGGCTGCGGCTGCTGCTGGTTGTTGTTGATCTTGCGCTGGCCGCGGACGGACGCCGCGGGGCTCCGGAT
CGCCGATGCATTCTTGGAGTCTGAGCAGCTCTTTTGCTTTGTGAGCTTTCCATCGGATTCTTTCAGTTGCGTGAAGATTTTATGTTGCGCTTAAAGTTTC
ACGCACCTTTAACACCGCGCGCAACTTCGGCGAGTAGTTTAAAAAACCGACACCAAGGCTGGCCATGGAGACGCTGGCGCCCAGGTGCAGCGCTATCTGG
ATGCGTACGTGTACGAGAACGCGCGGTTCCTAGCAGAGACTCGTGGCGCAGGTAAACAACCGCTTGGATCGGATTTGAACGCACTGAAAGCTGCGATGCT
GCTGTTTTAAACGCAATAAGTATCTACGTCATTTTAACACTTTTTGACCATTTATCGCTGTTACACGCAGCGTCCGAGCGAGGAGAACGTCTGCTGTTAG
CCACGTGCTACTACCGCAATGGACAGCAGCTCGGGCGTCGGCGGTGCTGAGTGGCGCCACACGACCGGATAATCGCTACTTGCTGGCTTGCTGCTGCTTC
CAGCAGGGACAACTGGTCGAGGCGGAGAACGCGCTGCTAGGAGGTGAAAACTGCCACGTCGATGATGCAGAGACAGTTGAGAACATACCTGCGGGAGCTG
CTGGGTTGTTTCTACTTGGAAAAGTGTGCAGGCGTGGAAACAGGAGACAGCAGGCTGTTGCCTGCTTCGTGAAGAGGTGAGACGATGTTTCGGTTGATTG
ATTTTGTGGCGAGTTTATTGATCTTTGTGTTTGTGTTTGCGTTGTGTTGTGTTGGCGACGGAGTTAGTTTGGAGGTGGATCCGTTCATGTGGTCGGCGTA
CGAGCAGCTTTGCGAGCTTGGAGCCAATCTCGAGGCCTCGAGATTTTTCGGCGCAGCAAGCACCGGATCGGCAAATGAAGTGGATTCCGAATTTTCACTT
TGCCCGGAGTTTAGCGATGCAAGTGTTAAAGGTGGACATCAATTTGGTGATGAGGAAGGACACTACCGCGAGGACAACAACCCAGAGGATCGATCCACGG
ACGGAACATTGGGAACACCGGAGACTCCACTTTGTTTTCGCCCTTATACGCCTAAGAGCATTTTGACCTCATCGTTGAGCGCTTCTCGACCTATGGGTTA
TAAAACACCAATTGTCAACAGCAATAACGGGAAAGGTATGCATACAGCGACAGCCGTGAAGAAGCCGCGAATTGCAGAGGATATTGGTGCTCCTGTACGA
CACAGGAAGGTTCATCGCGACCTCTCGCAGACAGTGACGAAAAGAACCGAACCATTGCAAGGCTGTCATTCTCTGCTGCTGGCTTCGACGACTCTCCACT
GGTACGGAACCAATCAATATTGTACTTGAATGTAAACGTAGTGGACTGACTCATTATATTTTATCTGCGCAGAATCCGTCGAAATTAGCATTAGGCTCTC
CCATCTCCACTCGTTACCGACAAGACTCCTGGCCCTTTCCATAGAGAAGGATCATCACGTAATGGCCGGGAAGAGTTGCTCCGCCTGCTGAGTTCGTTTG
GCTCTATTTATCAAATGTTGAGTGTGTACAAGTGTCTAGAAGCTCTGGAAATGCTGGAACGGCTTCCTGACGCTCAGCGTGCATCCGGTTGGGCACAGCA
ACAGACTGGTCGAGCACATTTCGAAATGGCGGACTACGTGCGAGCGCACGAGGTGTTCTGTGCTTTGCACAGAGCGGAACCGCATCGGATGGAAGGTCTC
GACATGCACTCAACGACATTATGGCATCTTAAGGAGGAGGTGGAACTGTCGTATTTGGCTCAGCAAGCAACAGACTTTGACAAGTTATCGAGCGAGGCCT
GGTGTGTTGCTGGCAATTGTTTTAGCCTTCAAAAAGAGCACGACACAGCGTTGGCCTTCTTTCAGCGGGTAAGTTGGTTCGGTTGTATCACGAGAGTTCA
AATTGGCATTGCTGACGTATCCTACGGTATGTCTGCTATTAGGCTATTCAACTGGACCCGTCGTTCACATACGCGTACACGCTCTCTGGTCACGAGTACG
TCGCAAATGAAGATTTCGAGAAGGCAGTGAATTGCTACCGGCATGCAATTCGTACCGATTCACGGCACTATAATGCGTGGTACGGCCTGGGCGCGATCTA
CTACCGGCAAGAAAAGTTCGAGTTCGCCGAGTACCATTTCAAGCGTGCGCTCGAGATCAATCCTCGGAGCTCGCTGCTGCACTGCTTCCTAGGTATGGTT
CTACACGCCACCCAACGGTGTGACGAAGCCCTGACCACCCTCGCCACCGCCGCCGAGCTCCAGCCATTAAACCCCAAGCTCGGTTCCAGCGTGCCAATGT
CTTGATCACCCAACAGCGATACAAAGATGCTCTCGCAGAACTCCATGTCGTCAAGAACTTTGCGCCGCGCGAATCCTCGGTGCACTTCATGATGGGCAAA
GTGGCCAAGAAGCTCGGCCGAACCGAGGAGGCGATGAAGTACTTCACCTTGGCGCTGCACTTCCACCCGAAGGACAATAACCAGATCAAAATCGCCATCG
ACAAAATCAACGAACCGGACCATGACGACGACGACCGCATGTAGCGAGTCATCGATGCATCTGCAGCGCCAAAGCAGTAGCCTACGATATACTTTGAGGT
AGATAACAGCAGCATCAATGAAGCTTTTTCACCGGCCACATAGACATGGCCGTTTTGCTTTTATGTGGCATTTGAGATGGTGCCGCCAACAGTGAAAGTC
GAGGCGCTGCTGCTGCTGCAGCAACTCACGCTGTTCAAGGAGGCGAGCGAGGCACTCACCCGTCTGTTCGAAGGGTTCTCTGAGCAGGATTCCGGGCGCT
GCGCCGTGCTGTGGCAGCTTCTGCAATGGCAAAGCACAACCGCGTCCAGCAGCCTCGAGGATGTGCTGGTCGACTTAAAATCTAGCGGTGACAGCAGCCA
GACGGAGGTGCGTAGCGATATGGAGCTCACGGTGCTGGGCAAACCTGCTCTGCTGTTTGCCGCCTCCATCTACGACGAGGAACTCGCCATGTTGATCTGG
TCGGGGTTCGTCCAGTTCCACGCGCGCTACCCGCAGTTTGATCTGCCGCGGCAGGTGCTGGACAACTCGGACGACTCTTTGGGCTATTCGGCGCTGCATT
ATGCCGTGGAAGCGCAGATGACGGACTTCCTGCGTGCTGTGTGCAAGGAGTGACCCAAGCGCAGACAGCTCCTCTTGTCGGCCGAGTTGTGACGCAAGAC
GTGACTTTGCCAGTTAACACCGCGCACACCATGGGCAAGAACATTGCCAGTGGAGGCTGCTCGCTGCTTCATCTTGCGGCCAAGAAGGGCGAGTTGGAGA
TGGTGCAAATGCTGATTGCACCCCGATGCTCATGGACCCCAAGACACTGCGCGACTGGGACGGCAACTCTCCTGCTCGAGTGGCAGCCATCCACGGACGT
GACGAGGTCGCTGCCTTTCTAGAGGTACGGAAGTGCCAGAGCAGTTTGCGAAGTAGGTATTCTAATGGTTATTGTGGTGACTGCTTAGGGTATCACTGGG
GAAGCACCATTGAGTGTTTCGGAAGTCGATGACCTGCGAGCCAAGCGCGAGAAGATGGCCAGAGAGCGTTACCTGGCACACCTGAAGCCCCAGGAGTCCA
TGCTAGAGCCTTCAGTGTTTGCCAATATTTGGACTCTCGAGGAATCGACGCTGATCAGCGATGAAGTCAACCTCTTGGCCGCTGAGCAGGGTTGGTGCAA
GGAACGGCACGCGTCTTATCAAACGACGGACATGCCGTGCCACCACGTTGCTGGATTGAACTCCTGGGTGCGCGCGACCTTGGCGGACAGGCTCTTCCCT
CAAATTGCGAAGCGGTACAAGCTCCCCAAGAACCAGCGACTGCTTTTCCGTGACCTCTTTTTCGTCAAATACGAGGCACGCAATGGTGAACGTTCTGAGC
TTGCACTCCATCGCGACGGATCCGTGTTGTCTTTTAATGTGCTACTGAACTCGGCCGACGACTTCACGGGCGGTGGCACCTACTTCGACGCCACAAAACG
CACGGTGCACATTACACAAGGCGATGCAGCAGTTCATAGCGGAAAGGTTCTTCACGCCGGTGCCCCTGTGCTGTCAGGCATACGCCAAATTCTTGTGGGC
TTCCTGGACGTCGCCGACTGTGTGTACTGAGTGCCTTCACACTCACAAACGGCGAAATTGAATGCCTTCTATAGGCGTGTCTCCTTCAAGCACGTAGAGT
CTCGGACACCAATGCTTGTCATCGTACAGGTCGTCTTCTAGAGAAGTTTGGATGGAACTAGTGGCTTTAGCCTTCCCGAACGCAACACCACACACAACAT
TAGCAACACGATCCAAATAATAGAGCATACTTCAAAGTAGACAACTGAGACCATAACGTACCCGTTCGAGTTCAAAGAAGAGCAAGCGGTCTTCCCAAAT
TTTGTCGTAGTGTTCCCCAGCATCTACAACAATAAAAACAACAGCCGCAGCAGCTGATTAGACATGCTCGTGATGTTCATTGCTGTAAATACTGTACGTA
CGGCAATCAAGAGATTTAGGAGCATGATAGTGCCGATGACCACGAATGAAATGAAAAAGATCATTGCAAGCAGACCGCCTTCTGCGATGCTATCCCAATC
CCATGAACCCAGACTAATGTTGAATGTCGTAGTCAGCGCAGTAAAATAGCTCTTGCATCCCTCCAGCTTCAAGCACAACAAAACCAGAGATATGCTAAAT
ATTTTTCGTGCTCGTCCCAATATAACGCGCATCGACTGCATCGTACCTGAAGTATGAAAAACGCAAAGGCAAAGCCGCCCAGGAACACGCAGAATACCAT
GAGGAAAACCAGGATGTCGGAGAACATCTGCAGAAAGGTGAGTGCACAGTTAGCCCGGAGTTAGATACATTCCGTTGGACAGCGAACCCAACCTTCGCAA
TCATGCGAACAAATGGGCCGAGTGCTCTGGTGCCTCGTGCAAATTGAATCCACTTGACGAAGATTTGCGGTCCGACAATGCTCATAAGCGTGATACGGAA
ATTGTATCGCCTTCGAATGTTGGAGCTGTACAACGATTCTTGGTAGACGATGAGGCGGAAGTCGTCGTGATCGAAGTCTTGAATGAACACGAAGGTGTTC
GTTAACCCTAGAGTTAAGCGAGGAAGAAGTCACATGTACCATCAATTTACCTGGAAATATGAGCTCGAGGATCTCTGCGACGAGTAGGAGCCATACACAA
GCAATTTGCACCAGGTCGAACCAATTCCATCCATCTCGTAGGTATACACGAAGACTTCCGCATTCTCTGTATGCTTGATACTAATAAGGACACAAAACAG
TTTAACCCGCGGAAACCAGTGCCTATGGGACTACAGCATATAACTGTACCTCTTGGAGCGTGTACTTCGCGTTGATGACAGAGTAGACGAGTCGTGCTAC
ATCTCGAACGTATTCCATGCACCCAACCGTTTCGTTGAAAATATTATTGCGATAGCCTCCAAGTGGCATTCCCACAAACGTGTCACCCACATGCAAGTAC
CTGGGGTCCAATCCAGGTGTCAGCTGTTGCTAGACTTCATTGCCCATACACAATCAGAGAGTGGACGTACGTGGCAACGAAAACGGCAACAAAGTAAATG
AAGTACACTTTGAACTCGGACCTAAATGTCTGTCGCGTGAAAGAGTTCCATCTGCAGTGACAAACTTTAACCCCAAGCAATTTATGACGTCATTGCAATC
ATTACATGGCGATACGTACTTGTGGTCCAATAACTGTCGGAACCACGGGTGGAAAATGAGATCCTTGCATTCTGTCTGTCCCCCGTTAAGTCACGTTGAT
AGATCGTCAAGTTGGCTGATTAACCCAATCCAAAGATTAAAGCACCCTACCTGCACTATCAGCCACAATGTTGGGCTGTGTCGGCCCCGAAACTCTGCGT
GGTCGTAGACATATTCATACAAAATTCCTTTGGGCTCGCACACAATTCTTTCTTTATGCCCAGTTTCATTCTCCGTCACAGTAAACACGTGCTGGACGCT
CAATACACTCCTGATGTGACGCAGAAATTTCCACACTTTCTTCAAGGTTTTCCTCAACCTGTCGACTACGCGTTGCATTACACCCTGACTTCGCTTGCGT
CGAGGAGAGCGACCAACTTTTCCCTGGCCCTTCATCTGGACGATCAATGCGTCTCGCTTCTCGTGCAATGTTTTGATCATTGCCAACTGTCCAGGATTGG
TTGCGTTCTCGAACATGTCTTAGCATACTGCACCGGAACAATGGAATACGGAACGAATCCATTGCCAACACGGCTGCTTCAGGGACGTTCTGGATCAACA
GGTGGAACAGTTTGCTTCTCTCGTGTAGCTCCCGTGCTTTGTTCATTTCATAAATGGTCACATGCTCAGACACAACGAGTATACCCAGCGTTTTTCGTGG
TAAAATCGAATACCCGGGTGCTGACCGGAAGAACATGATGTCACGGCGATTTTTCGTGCATAAGAATGGAGATGTTAGTAAGCTGTCGACGTTGGAGCAT
GTGCTGTCATTCGCAGTACCGACAGCGTCGTGACGCGCATTAGCCCTTCCTGCCACAGTTTCAGGCGACACCGTGGCGGTATTTCCAGCTAAGATCTGGT
GTTGCGGCGGATGAGTTTTGGCTGCAGGTGGACGTTTGTGCTGAACCATAGCTCCCGAGCGAATGTTCACTGATGGCAATAGCTTGGCCATCGCTTTTCC
ATCAGGAGATTCCACAAACGTCCCTCGCAGGGCAGTTCCATTCACCATGGTGAATGACACATATCGCGACATCCGAACATCGGCATGATTCTCCACGAGA
TGAAGACAAACTCCACGACGTTGACTAGCTATCGCAAAGTGAAGTCTATGCGTGAAAATAAGAGTAGTTAGTGCAAAGAAGTAAGCCGGGGCACAGCGAT
TTTTACGTTGATGTGACCACTAGGCATACTTACGGTGTCTCTCCGGCTTTGTTTTGAGCATTAATGTTCGCCCCATTTGTCAATAGAAGCTTGCACAACG
TGAGATGCCCACCTTCAGCAGCAAAATGGAGTGGCGTGTTGCCAGCTGCATCTTTCGATAGAACCAAGGGGTGACCACAAATTTGCAAAAGATCCTGCAA
TGTGATGGCATCCTCGTGCAGCTTGTCGAGAGAGTCCGAGAAGCGAGCGAAAGATACGCCAACATTTGCCACGAGAGCTCTCATCTCAACATCCGACTCA
CTCACCAGCCGCTTAGCTTTACGCATTTCGAGAATCATCTCCAGCAGGTGAGTGAGTTGCATGAAGCTGTACTTTTGGTATGGAGAGTTCATTGGGTGCT
CGTTCCAATGCATGATCAGCTCGCTAACGAGAGCCGTATATCCTCGTTGAGTCGCTGCGTGCGTCACCGTGTACCTGCAAGACGAGAAGCTTCAGTATAC
TGCATCAAACCGTCAATGCAGCACGGAGGTACGTACTGAGCTAAACCGTGTGGTTGCAGGAGGTCGAGTCCGTCATTCGCTTCGTTCCGCAGGATCCGAA
GGATCTTTGGTAGATTAGGTTCTGCAAGTCGAAGGACGCCGCTTTCAGTCCTCATTGGTCCAGGTACAAGTGGTCTGCATTGGCAGCACTCATCAAAGAG
TAGCTTGCTTTGCAGCGCGAGGTGCTGTTCATCTCGCTTCTCCAGCAGTAGGTGCATCCGATAGTATCTACGCATGGCTCGGTTGATTTTATCCGCCGCC
CAGCCCTCGGGTCGCTCATCATGGTCATGTCGAAACTGACCTGCTAGGAACTTCTTGATGTAGTTTCCGCCTTGCACCATGCGCGTCGGACTCTCCTTGA
TTTCGTTCTTCCCTGTGTGCGGGGTATTGTAACGAATGTGCTGCGCTCGAATATGTTCTTGCCTGAGCTGCAGACGTGGAGGTCGTTTGCGCACGTCTTC
CAAAATCACCTGCTTATGCTGCCTCTTCTTGTTCGCTCGAGCCTCCTGCTCGTCCACGCAGCAAAGTCAGCAAACAGTACTAAAAGCCCTCCAATTCGAT
CAAAACGCCACCTTGATATGCGCTCGATACGCCTCCAGCATCTCGTCACGCGTCGCCGGAATCCCGCAGACTGCATCGCCGTAGTGTAGCGCTTTGCAGA
CTCGGACGCCTTCTCCAGATTCTCAAAGATCGCCCAAAAATTAAGACGGTTTAGATATGGACTTTCGATTTCCATATTTAACAAACACACTATCGGAAGT
GTCGTATTGATTTGCTTTTTGTATTACATGTACATTTATTGGCCGGAATGGTGGAGGACGCCTTAGCTGCTGCATCCATGGACGGCGAGTTCTTCTCGTT
CCCGTACACGCCGTACTCCATCCAGCTGGACCTGATGCATCAGCTGTGGGAGACGCTGGAGCAGGGCCACTGCGGCATCTTCGAGAGTCCTACAGGCACG
GGTAAGTCCATCAGCCTCATCTGCGGCGCGCTCACATGGCTCACGAGGCACACGGACGAGTTCGGACTGCTGCAAGCGCTGGGGACTACAGATAAAGTCG
ATGCAATTGATACGGAAGCAGAAAAACGCAAGAAAATTGCCGAACCGAGTTGGCTCGACGACTTCGAGCAGAGGAAGGCGGATCGGGAGGTCAAGTATCG
CCAGCAGGTGGCTAAGAACGCGCTGGCTGGGATCAGGAAGCTCCGACTAGAGCCGGAGGCCACCACGAAGAAGCGCAAAATGCGGCATGCGTACAACCAT
CAAGAGCGGAAGCGGGTGCATCAGGGCAGCAGCAAAGTGACCAAGGACGGAGAAGACGAACACTTGGTGGACGCCTACGACAGCGATCGTGTAAGTCGCC
AAACTAGTGACAATGAGGAAGAGAGCGGCGGGGGTTCGCTGGGGGTGAGAGGTCGTTTTGGAGACGAGAAGCCGGATTTCGGCGTCGTGAAGATCATTTA
CTGTAGTCGAACGCACTCGCAGATCTCGCAGTTTGTCAGGGAAATACGAAAGACGGTGTTTGCGGAGCATATCCGAGTGGTGTCTTTGGGCTCTCGCAAG
AATTTGTGCACAAACCCGGATGTTACGAAGCTGGGCTCGGATTTGAGAATGGCGGACAAATGTCTGGATATGATGCAAGGCGGCAAGAGCAAGAAAGGCA
AGAAAGTCGGCAAGTGCCCGTTCTATGAGAAAGAGCTGCTCGGTCACTACAAAGACTATGCCCTCGTGAGTCTCGTGTTTTATTTATTGTTTTTGGTGCC
TGAGTGATTAACAAGTTACCGTTTGTGCAGGCTGAAGTGCAGGACATTGAGACCTGCACACGCTGGTGAAGAAATGTCTATTTGCTCGTACTACGGCACT
CGTGAGAGCATCTCGCTTGCTCAAATTGTCACGGTGCCGTATTCCATGTTACTGAGCAAAGATACCCGGGAGACACTGGGCATTGCACTGGAAGATAACA
TTGTCATCTTTGACGAGGCGCACAACATCATTGATGCAATCAACAACACGTACAAGGTCGAAATCACCAGTAAGCAACTGGTCGTCGTGCGACGAAGCCT
ATGGTCTTATTTCTCGAAGTATGAGAAGCGCTTCAAGGGTAAGAACGCGTTCTACATCAAGCAGCTGCTGTCGATCTTGGAGTGCTTGACGAAATTCCTT
CGGCAACTGAGCAAGTCTGCTGGAAAATCCTCATCGACAGGTGACGAAGACGATGGCGCCCCAGGAGCACAGATGCTGACAATCAATGATTTCTTGTTCA
GTGCTCGGATAGACCACTTCAATATGTTCAAGATTCTGGAATATCTAAGGGAAAGCGGTCTGGCAAAGAAGTTGATGGGGTTCGTCGAGTCAGCAAACGC
TGGCGCTCCTGCAGAGGCACCGCCGCCACAATCTGTTTTAGACGATACAGACGAAGGCTTCCAGAGCCGGCATATCTCGCCACTCCGAACTGTCGAGGCT
TTGCTAAAGGCCTTGACCAGCGTAGGCGGCGATGGCCGTATTCTCGCACAACCGCATAATGTAAGCTCTGAAGCCCTGTTTCGACGTCGATAACGTGATT
CCTAACTATTGTTTCTGTGCCCAGGCGAGCAAAGGTGTTGAAGGTTTGATAAGGTTCATTTTGCTCAATCCGGTCATACATTTCCAAGAAATCGTGAGAA
AGGCACGGAGCGTCATCCTCGCCGGAGGAACAATGCAGCCGGTGAGCAATAAGTATTCAAATTTGCAACCCTGTATATAACTAACATTTAGCTGCACGGT
AGGTGTCTCAAATGATCGACCAACTATTATCTTCCGTCCCAAAAGAAGACGTTGATTTGTTCTCCTGTGGACACGTGATTCCCCCGAAAATCTGCTTGGA
TTCAGCCTTACGTCGGGTCCTTCACAGAAGCACCTCGAATTTACGTACTCTCGGCGAGGCGATATGGAAGCGCTGGACGAGCTAGGGCGCATCCTACTGA
ACCTTTCACGCATTGTTCCAGGTGGGTGGTTGTATTTTTCCTTCTTACCGGTTTGAAGAGAATGCAGTGCATCGATGGAAAGCCACAAACCAGTACGAGC
AGATTCAAGCAAAGAAGACCGTTTTCAGCGAGCCGAAGAAGTCCGATGAACTCGCAAATGTGCTAATGCAGTATTCTGCAGCGTGCTCTCAAAGTAACCG
TGACGGAAGTGGTGCGATGCTGTTGAGTGTGGTTGGCGGCAAAATGTCAGAGGGAATCAATTTCAGTGACGAGTTAGCTCGGTGCGTTGTGATGGTGGGG
ATGCCCTATCCAAATGCCCGAGATGCAGAGCTCGTCGAGAAAATGGCTTTCCTAGACAAGAAACCCCGGGATCAGGGCGACAGTTCTACGAGAGTCTGTG
CATGAAAGCGGTCAACCAGTCAATTGGTACGTGCGATTCTGGTATGCTTCTGCCCCTTCCTCCCTCTAATCCGTGTTCTCTTCGCAAACTTTTCAAAACA
CAACAGGAAGGTCTATCCGCCATCAAAATGACTACTCCACGATTCTGCTAGTTGACCATCGATACGCAAGCCCAGCCGTCCGCAGCCGCCTGCCAGAGTG
GATTCAAAAGCGCGTTCAACCTCCATCATCAGCCAAGTCGTTTGGACAGGTGTACTCGCAACTCGTGCAATTCTATCGAGCGAAGGAAAGCCAGGATCGT
CGACCGGTCGATAAATAACACGAAGTCTTCCCAAATTCCTATTGAATTCCTTACAATAGATCTGCAGCAATAGGTAACGTTGTGTGAAAAGAAATACTTC
GACGAGGGTGCCCGAGAGTGTATGTGACGGCATATCATACAGACGTCAGCTTGAAGATCATCCTTTATCATTGGGATAAGCTACTTTGCTAGCTGTTTCT
TGTATTCAGCGTGAATGACTTGTTTCGCAATGCCCAGTACTCGACCTGCAAGAGCTTCGTCGTCGTAAGACCATTCCATGTGCACTTCCCACTCAGTAGA
CACTGACACTCCAACTGTACGAAGCTTCAGCCAACGATCAATCTTCTCAATGGCAAGATGGCGAATCCACTTGATAAGACTGGCCTCTAATGCTTTCAGA
AGTTCGCCCACATTCGCTTGAAGCTGCTCCTCTTATCATTATCTTCATCAGCTGACTCAACTGCAGCTGAAAGTAGAAAAGATAGAGCTGATGCGGGGCG
GGAGCTTTTCTTCTTCACCCGAGGCGAAGGCTCGAAGGGCTTCTTCCAGGAGTACGAGAAGAAAAGTGAGTGTTTCTTCTTTTTCAAACGCCGTGCGCCA
TTGCCAGCTGACACAAGCATCAGCTTGCGCTTTGGCTCAGCAATCAACATACCCTGCACATCCGAAGGGTTGTTAAACATAGCCTTGTGAATGCGTAGCG
GGATATCCCGGGCAGGTTCAATGGGAGTTCGCCCTGTAGGATTGACCCCTTTCACAGTCACGCTGGTGTCGACAGTTGGGTCCATCTTCATCTGGTTCTG
GACGTGTGTCTGGACAAATGCCAGGTCGTCTGGGACCGTATAATCGAGAATGACCTGGCGTGGCGCTACGCGTGATACAAGCTGGACAATGCTCTTAGTG
TCCACTTCATCTCCACAAGGTTGGTAGTGTACCCCACATTCCACGTTCACACCTAAGCGCTTGCTAACGCGCTTACGCTCAGGGTCTGCGTAGAGCAAAT
AGTTTACTGTGCCCGGTGTGCAATACTCTGATAACACGATGAGATTCTTTGGGTCACTCGCAACCGCCTTAATCGCACGTAACGAGTCACCCTGAGAAAT
GTTGGCTGGTCCTGTAAACAGCACGAACGGTCCAGGTTGCTGCAGCCGCTTCCAATCGAACACCTGCAGGTCAGCAGCGTTTGGAGACCTTTCACGCAGC
AAATTTTGCACCGCATGCGTGCACGTGCGCGACAACAGCGGCAAGAACCGGCTTGGATACTCCATGGCCGAGTCCGACAGGTAGATCGGACACTGCGCCG
ATTTCCCGGTAGCATCCTTCATCTGTTGCCAGTGCTCCAGCAGAATCGTAATCAACTCATGGAAGTACCCGAGACGGTATACAGGAATCACCACTTTGCC
GTTCGAGCTGATACATTCCAGAATGACTTTCACAAGCTCCCTTTCCATGGCGCTCTGCGTCTCCGATACAGTCACGGCAAAGGAACTGCGCGTAATCAGC
GCACTCGGTTCCAATCGTGGAATCTGCGCCGGCAGCAGCACTCGGCCACCCGTAAGGTTAAAGTCGTTTGCAAACAACACCGTCGTCGTCCCGATCTCCA
AGTAAAAAGCACACCCGCCCGCCACATGACCGGAATGGTAAGCTGTTACCTTGAGGTTCTCGTTCACAGTAACACAGGCCTTCAACGCAACAGCTTTGGC
TTTCCTGAACGCCGCAGCAATATCCTGAATGTCGTACGGAGCTGGCAGGCCGCTGCCTCCGTCTTTCGCCTTGCCGTGGCACCCAGTCCTACAGCACCAA
ATTGTCAGCACTTTCATAAAATACAGATATTATCTGTCTACAATTTCCTATCCCTCACCAGTATTCAGCCAGCAGATGCGGCGCGATGGCCCGCGTGCCG
TGCGTCATGAGGACCGCTGGAGGCTGTTTCTGGCTCGGATCTTGCGCTGCAGCGGCCGTTGCAGTCGCCCACGACACACCGCACTTCTCGGCTACATAGG
GCAGCATGTAACACGCTCCGGGGCGGTAATCCGGCACCAGAATGGCATCTAAAATGCCGCCATCGCGTTTCAGGAGGTCCTTTAGCTCGCGCCGGTACTG
CGTTGTCACCGCCTCAAAGTCCTCGGCGCCCGCATCGTCGCCAGAGAAGAAGGACACGTCTTTCGCCTCCCCGCAGCCCAGGAGCACCGTCGTGCTCGAG
AGCTCGTCGCGCAGGCAAAAAGCCGCGCCATTCCCAAGCCTCTCCACTGAAAAGCTCATGGTTTTGTTGTACTATGAGAGGGGGCGAATGACCAGATCAG
AATCTGATAGAGTCTGAGGAATCTGAGTATGTTTTTGTGGGTGTCCTTGTAGACTCAAATTGGTCCTCCGTGACCCGTACAACATTTTTTCAGTCTAACC
ATGTATGCGTATCTATCCCTTGTGGTCCTTCGAGCCTGTACAAGCAGCAAGTGGATGCTACGTCCTGCATCTAGAACTTGCCAGCTTGAATAAGTCCGTC
AAAATAAGCTGGCAGTTTGTCCAGTGGCAGGAACGTTTTCTCCATCGTTGCTCGTGTCTGTACCTCAACGAGGCCTTCCTTCACGAAGCGCTTGCCAACT
ACGACACGATACGGGTACCCGATAAGCTCGGACTCGGCAAGCTTAGAACCCGGGCTTTCACGCCAGCGGTCATCCAGCAACACGTCGTCCCTGACCAGGC
CGGTCACCTTGCCAGAAGCTAGTTGGTCAGCGATATCCCATGCAGCCTGGGACACGGGGTCTTCCTGCTTCTTCCCACCGATGGACATGACGAGGATCTT
GAACGGAGCGATCTCGGTGGGCCACGCGATGCCGCGGTCATCGTGGGAGGCCTCCACTGCTGCGGCCACAAGCCGGCTAACACCAAGGCCGTAGCAACCC
ATCTCTAGCGGGTGCTTCTTGTTCTTGGCGTCTGTGTACGTCGCTCCGAATGGCTTCGAGTACTTTTGGCCCAGGTAGAAAACGTGGCCTACCTCGATAC
CGCGCTTGTCCTCGAGCACTGCAGCGTCGCCGCCATTGCAGCGCGGGCAGTGGTCACCCGCCTGAGCCAAGCGAAATTGGCCCCACACAGCGTGGGTACG
CGTCTGTTGCTGTGGCAGGGCCTCGACAGCCGCACAAAGAGCTTTCACGGCACGGGTAGCGTGCTCATTATGCTTCAGTGAATCATCCAGAAGCACATGC
AGCTCCACAGAGGGAAAATGCCCGCCCAGTAGCTCAGCGATCTTCCTTGTGTCCTTGATCACTTCGCCTTCGTCACCACCAATAAACGGCTTGATTGCAA
GCTCATTTACCTCCCTGTCGTGTCGAGCAAAGCAAAGAGCCCACCGGGGAAGAGACTTATCTTCCTCCTCGTCGTCGAAAGCCTCAGAGTCACAGCTCTC
CACCTGCTCCTGAACCAGCTTAACCGAAAACCCGTGGTCCTCTGCTGCCTCCTGAAGGTCCATCACAGTCTTCCAGACCTTCTCGTCTCCAGTTCGAGCC
TGTTCCTCGAGCTGCGCAATGATGGCGCCAAGCTCTGTCGAGACCTCGCCATTTACCGTCTGCTCCGAAGATGGCAAAAGCCCCTGCGCTTTCTCCACAT
TCGCCGCATAGTCACACTCTGCCGACGAACACGACAGAATCGCGTCTTCGCCGATATCAGCCAGCACGTGGAACTCGTGTGAGAGATTGCCACCGATATT
CCCCGAGTCGGCCTCCACGCGCTTGACCGGCAGCTTGAGTCTCGAGACCAAGATCTGGTTGTACGCCGCAGTGACGTCCTGGTACGTCTGCAACGCACCG
TCGTACGAGGCGTCAAAGGAGTACATGTCCTTCATCACAAACTCTCTCGCTCTCAACAGACCAAATCTCGGTCGAATTTCGTCGCGAAACTTGCGGCCGA
TCTGGTACAGTCGGAGCGACGCGTCTACAGCGCCCGCAGCTGAGTAATGCGCTGCCACGAGGCTCGTGACGCTCTCCTCGTGAGTGGGTCCGAGCACCAA
CACGTCTTCTCGGCGGTCCTCGAGCGCCATGAGCTCCGGGCCGCGGCTCTGCCAGCGCCCCGACTGCTTCCATAGCTCGTGAGCGTTAGCACAGCCAGGT
CCACGCGGTTGCCACCAATTTTGTGCATCTCGTCATCGATGAGCGCCTCCAGTTTGGCTACAACAAGGCGGCCGAGCGGCAGCAGCGCGAAGAGGCCGTG
GCCGCTTTTGCGCACGAAGCCGCCGCGCACCAGCAGCTGGTGGCTGAGAACCGCTGCGTCTGACGGCGCCTCCTTCTCCGTGGGCGCCCACAACACAGAA
CGCAAGGCGCAGGGGGCGGCGCGTACCGCCTGGGACGACGACAGGCGCCGCTCGGCCGTCGCCAAGGACCTACGGCGAGCAGCCCACATGAGCAGCGATT
TGAGCCGCAAAAAAGGCAAGTATCTCTGGTGTGTGGCGTACACCACATTATTTTACGACATGGCTTCGTTTTTCTCTGCAATGGACTCCCTTCAACAAGT
AAAAAATTGGCATGGGATACTGTCGGAAGCCCCGCAAGATGATGAAGGAAGCAAATTTACCCCTGGACAGCGGAGTCGGTCGAGTTCGTCTTGTTCGCTG
CAAATGCTGGGCTGACTCATCAGCTGGGGAGAATAGTTGTTGCTGGTACAGTCGAGCGCCGGAACCTGTCCGACTTGGCCAACCCCGCAGTCGCCTATTC
GTGTTCCGTCACTTGTCGTCGCCACGTCCGTTTGCACGCAGTGTCGGGCTCTCGTCATGTGCGGCGTCGACACTCGCACGGTTTCAGGGCGTTATTGCCA
ACAAGTCCATTGCCGAGGACAGGTTGCACTCAGGATAGGTACACTTGCCCCACAGCAACAGCTCCAACTCGCACGCAACGCATCCAAAGTCCAACGCAAG
AGAAAAAGTGTAGGCTGGATATTGTGGTCCGTAATATCATGTGCATCTCCGCATACACCGCCACATCCGACCCCGTCTCCGTCCCATAATACCCTATGCC
AATTAAACCGGCTGGCGACCTTGACGTTGTCCGAAAAATACAAGCAGGTGCCAAGTCCCAGTTTAGTTTCTGCCGCCTCGATCGATGGCTTCAGCTTGGC
GCCAGCATCCGCACGATCCGTGGGACCTGCCGTCGCCGCCGCCGCTACTAGAAGAAGCCGCGCCCAAAGCTTCCAAGCGCTCACACTTTTCACGCCGCAG
CACGCGCGCCCAGAGCCAAGCGAGAGCCCAAGCGCAGCAGGCGGAGCTCGAGGTGGAGGCGCTCGCCGACCAGCGCGACCGACGAGCGCCGCAGCCTCCT
GGCCGCCATGTTCGGTGGTCGCAGCAAGTCACGCACGTCGCGATCGTCCTCGGACGCCCCGCAGACGCTCGTGCAGCGAGAAAAGGCCTTCCGCCTCGTG
CGCCACGGCTCGGACCCGCTGCTGAACGACGCGTTCTACGCCACGCAGGTGCAGGTAGGCAACTTCGTCAAGATGGGCTGGCTCACCAAGCAGGGCCACA
TGTGGAAGAGCTGGAAGACGCGCTTTTTTGTGCTCTTCTCGGACGGAACGTTCGCCTACTACAAGAACAAGGGCCGCAAGAAAATCAAGGGCTGCATGCA
GCTCAATGACGGCGTCGTGTCCGTGCAACACGTGGACGTCCGCGTGGCGGACAAGGCCTACGTATTCCAGATAGAGAAGGGGTTTTACAAGCTGCTGTGT
TATTGCTGCAGCCAGTTTGAGGCCGAGCTGTGGGTCGCAGCGCTGCGCTCGGTGCGGAGAGTGACCCCGCCCTGTTACGAGACGGATCTAACGGCCACTG
AGGAGAAGGCGGGCTCCAACGCGGTCACGAGACACTTGAACAAGATTTTCATCACAGATAAGCAGATCGCCAAGAGTTTGGTGCAGTTCAAGGTGAACGA
GCACGACCATTCGTACGCAGCAATTCACAATTTTATTGTCGAGCTGGACGACGCGATCATTGATGGTCATCATTTGGAGCTCTATCAGGACCCAGAGATT
GAGCTGCTGCCTGGTAATGACCTGGTACGGCTGATTCGTCGACATGTGGAAGATCGAGTGTTTATTCCGTTGTATGCGGAGGCGTACGCGAGCTTGGAGA
CGGACAAGGTCAAGACGAGGCGCAGCAACCTCGAGCAGAACCTCAAGGTGCTGAGGCGGAAAACTCAGGCAGATTTTGGCATCTCGAAGGATTTATCCGT
TTGCGACTGGAAGCTAGCCATCAATGTGATTAACATGCTCGAATGCGTGTCGCTCCCAACGCACAAGTTCGAGGTCATTTTATCAGCTGGAAAGGCCATC
ACGGAGTCTATTGCTCAATATAACGGCGACCTGTTCGAGGTATCAGATGAGACGCTGACGGCGGTTTTTCGGTACGTAGTTACAATGCGTCACTGAGCGA
TTTACCGATTCTGCGAGCGCTTCTCAAGTACGGATACCAGCACCACCCAGCGTGTCAGAACAAAGCAAACGTCGTTTCAGCTTTCCTCGATGGGATCAAA
TGGGTGGAGTGCTTCGAGACTGGCGATGAAAGCTATCAGTTTGATTCCTTAGCGCTAGCAGGGTCTCGCGTGTCGGTATCCATCTCGACTAACGATGTCG
GCATTCAGTTTACGACCGATGGCAATGGTAGAGGGGCTATTGTTTACAGTGTGCGAAAGCAATCACAAGCAGCACTTAGCGCTTCAATCGTCCCTGGATT
GTCGCTGATTGCCATCAACCACGAACCAGTTATCGGGATGCCTTTCGACAAGATTATCCAGCGCGTGCGAACTGCGGCACTCCCTAAGCAACTCATTTTC
ATGACCGAGTTTTACTACTACCAGCTTCTTTCGCTGGATTCGGAGATGTTTCGATACCTAATGTGTATTGCAGCGCGCCGTGGGGACTTGGATTCGGCTG
CTTGGCTGCGGTCGTCCACGGTGGAGCTCAATAAACTTTGCTCGTGGGAAAAATCTCGAGGAAAACAGGTCTTTGGATTCATCCCTGTATCTGGGAAGGG
ATCCCCACTTCACGCGGCAGTGCATAACGGTCAACTCTCTATGGTGAAGTATCTTATCTCAAGAGGGGCTGATACGAACTTGTGCAATCAGAAAGGAAGA
CGCCCACTTCATGTCGTGAAGCAGTCGATTGATATGGCGTTGATCATTGAGAGCCTTATTGATGCGGGAGCTGACATTGACGTAGCGGAAAAACACGGTC
TTACCCCGCTAATGTTCATGTGCTTTAGAGCATCGCTTGAAGGTGCCGCGACGCTTGTAGCACTTGGAGCAGATGTTCGCCGTGTTGCATGGTCGAATGG
ATTTTCGGCTCTGGAGTTTGCAGTGAAGAGTGAACGAACAGAGCTGGTAGAGTTGTGCCTTTCAAAGGGGGCAAATCCAAATATGCCTACGCTGGACGGA
AACACAAGTTTGCATATGGCAGCCGCTCTCCCCCACGCTGATATAATCCTCCGGCTCCTACAGAGCGGTGCAAACCCCAATGTTCAGAATCGGTATGGTC
AGACTCCGGCCACAGTCCTACTTGCGTCTGCTCCTGGTGGAGGTGGCGATGCCCGAATCCTGTGTCTGGAGATTTTAACATGTGCCGGTTGCGGTTGGAC
AAACGTGATCTCTTTGGTCGCCAGGCTTCTCACCTGGCAAACATCTCGCGAGATTCTCATGTCATGGGTCTACTTCGAAAGTTGGGATCGCTGAACCGAG
CAGGCAATAGCGTTGATGTCGATATCTTCGGTTGCTCATCTGTTGATTATAGTCATGGGATCGAGGTAAGCAAGGCGACAGAATATTTTGGATCGCAAAT
GCCGAACAATTCGTGGGAAATCATGACAAGACCGACCACGTGTCTCGATCTGCACTCTCGGGTTCTGTCGAGGATTTGATTCGCAAGTTAGTTGCAGGCA
CGGAAGTGGACTTGGTGGATGTGGTGGCGTTCGTGCTCTTCTTGGACAGCTTCTCGAGTCTTAACGAATTGGTGGATCGGTTGAGCGAGCATGTCCGAAA
CGGGATTAAAAGTAAGTTTTGTGCGTGCTTGTTTGTTAATCCTTCGCGCGGTCAATATGCACCTACATTAGACACTAACGTGGCATTTACCCATTTGTAT
TGTTCGTATAGGCCACGGACTTATCCGTCTCTTCATCATGATCCTGCTTTTTAGAAATACGGAAACGAAGGAAGTAGATGATCTGTCTGATCGCTTCTAC
AGCCTGATCAGTCACAACATTGACGTCCCTAGGGAAAAGTTGGTACCTCTTGTTGATGAGTATACCTCCCTTTATAGGGAATATTTCTCATTGCGAGGAG
CTGGAAACTACGCCACAAATTACGAAAGGATTCCAGAAATGATGACTAAGATATACGGCTTGGAGTCAGGCATTGAGTTCGTATCCAACGAGCCCTTTCC
GCTTCATTTGCACCGGTAAGTCGAGTGATAGCTCATTGTCTCCCTTTTGATCGAACATATCTGACCTATGGATTTCGGTCCTCTTTCGTTGGGTAATATC
TCAGGTATATTGATGCAGAACGGTGGGCTGAACAGTGCACGCTTCTGACGCACGCAGTCTTTTGCCAGATTCCAGGTGGGATGTTATCGTCTGCTTGTTT
AGTTGGAGGGTTGACTAAACTTTGCTGTCTCTAAAATGCAGTCCAAGATTTGATTTTGACAGGCTCGAAAAAGCAGCACTCCGTTGAATTTACGAGTATC
AAACGATGGTTTCAGCACGTACGTTCTGTTGTCGCTTTATATTTACGTGCTAAAGAGATTAACTTTCGGGCGTTTTTGTCGTGGCAATATTGTGTAGATC
TCTGCGTACGTGATCAACGCTGTTCTTGTACAAAACTCCCCAGAAGAGCGTGCCGAAGTAATTTCGTTTTATCTCAAGGTAAAAGGATATTTCGGCTCGT
TTGACCTCTGGTGGGCTGCATGCTAACCTTTGATTTCGAACTATGATCAGGCCGCCGATTATTGCGTGTCATTACACAATCATGATACGCTGGCTTCGAT
CTTATACGCATTGCAATCTACTGCGGTACAACGGCTTAGAAAGTCGATCGATTGTGTACGTTATTACCAGCTATGTTCCTCTCGTGGGCACGAAGTCACG
AATTCTGATTTGGTGGTGCATTACAGCTAAGTGCGGAAGCGAAGAAGATGATGAACGAAATGCAGCTACTTTCCGACAAAGGATGTCGCGAGATGAACCG
GTTGATGCGCAAAACTGTCAACCCCAGTATGCCTTATATTGGGTTGTATCTCCAGGTAAAGACGCGCATTTCAAAGTGATGCCTTCGGACGAAAATGTCT
GACATTGTGCGTGTTGATTTAGGGCTTCCGTCGGACTGAACGAGTTGCCTGCGTTTGGCAAAGAGGGTCAAGTCAATGCGAGTCGGCTACGAAAAATGGG
CGAGTTGGCAATGGAAATCTTGCACCGCCAGTCTGTTGCGTACACTCTTCAAAACGACGAGAGTATTGATGTGAGTAGCAATTTTGCCTGTCGTCGTAAT
CCTCAGCTGTGGATATCACGTCTAACCTGCGAATGTAACTCTTTTGCAGAAACTGTTGCACGTTTCAATGCCGTATTCGTCGGAGGAGAGTCGATATGCT
CGGTCATTGGAGGTCGAGCCGCGTGAAGCAGATGCGATTCCATTGAGCGATCGCGGTTCGTGTGTTGTTGTTGATGACGACCTCGACCTTGAAAATGAAG
TTCGCGAGTCAGTTGGCGGCGATGGAACCTTTGGATTCCGCCAGTGGATTAGGAAGCAGCAAGTCGTGCACCGCAATCGCTCACGCTCTTCGCTGATAGC
TTTGTACGAGTGGGTGTAGCTGTGATGTGCTGTCTTCTGCGCCGTGCTTTGGTGAATACTTTTATCTATTCGTTGTGGAATGTTTTCGCCCAACATTAAT
ACATTAGCATATTTAGTTATCAGCGATGTACTTCTCGAAGTCTTCCATCGACATCATGGCGTCCGGATCCAGCGATAGTTCAGCGGGGTCCTTTATCAGC
AAATGGCGCTCATTAAGTTAACCACTTGTGCGCAGTTGTCATCACATGACCAACGTACCTGCTTGTCCTTGTCCTGCTTGTGCTCGTCAGCACCGAAAAG
ATCGTTTTGCGACTTTAACACTGGTGACGGCGGATCATCCGTCGTCAGGTCTTCCATCTGCTGCATGATTTGATCTCCCTTTTCCCCAAGCATGTAGTCA
TCTCTTCAGACGCGAACATCACCATGTTAGTGCCGCTGTTCAATGTCGCTTCTTGTATGCCTCGACGTACAGGAGGCGATTCAGCTGGATATCGCTGGCT
GCAGGAACGGTACCATCCGACTCGGGTTGAGACTTCTAATAGTACGACAATCTCCACAAACTAAGGCCAAAGTACCAATGCTCGTCAATTGTAGCTAATA
TTGCTGCCCACCTCCGTCTTGGAGAAGAGGTCGTGTGGCTCTCGGCGCATCTGCGGACGCTTCGTCTTGCTGTCCTTTGTAATATTCTGCCAGTGGTGGA
TCTTGGTCACAATGTCTCTGACGACACATTCTCCGTCAATGCAATTAGCACTTGCGAGAGTGATAAACTGCGTCGCCTACTCGTCTTCCTCTTCGTCGGC
GAAGAATCCACCTCCGTTGTGGGAATTCGCTTGGTCCCCACAGCGCGCCACCTTCTTTGATTCGTTCGCAGGGGCAACGTAGCCATCCGTATGCGCCGCA
TCAAAAAAGGAAAATGCTACGATGAAGGCACGTAAATTCACAATAAAATAGTTTGGTCATCTTGTCAGTGCAAGCATTTCGACGCCCTTACTAAATCTCG
TCTTGTGCTCCGCCATCTTCGTGGTCAAAGCTTCTGGAAAAGATCCAATTGTAGAGTGGTACACGGTACCGGTGTTGAAGCTTGAGCACGGTAACTTCGA
ACTTACTTGCGCGCCGAGCACTGCCCATGGAGGTCTATCCACTGGGTAGACCTCTATATAGCCAAGTAGACTTTACTGTCATGCAGAAGTACGCTAAAGT
GTAGCGGCTAAACTAATGAGAGCTAGCGTTGGTGAGCGATTGGATGCTCGTGGAAGGGTTGGAACAAAATGTCGGCTGGATTACAACGTGTACAATAGAT
TACAGGCCGCGCACATCCAACACGCCTCTCTTGAATCGCCCCTTGGTAGCCTGCACGCCATAGTCGACCTTCTTTCGCTTTTGGTGGTCTCTCGAGTCGC
CGCTCGATTTCCGCTTCCCTGTCACCACGTCCGACTCCTTCAACTGAGTGGTCGTACAGCGAAAGCAACAGCAATAGTAGCAAGAGTGAACATGCTACAA
CCGACAACAATCACAAAACACCTCAACCACAAGACGTACCAGCTCCTCGCGACGTTGCTTGCGAGCCACGCCCTTCGTCTTCAATCCGATAAGCACCTTG
TAGGGCACGCTGCGGTTCTTCGCCGCTTTGCCACCCAATGCCTCGATTTTCTTGGCCTCGTGCGCCTTCTTCTCTTTTCCCTTTAAGCTTGAGCTGGCTG
CCACCGTCAACGCCAGGCACCAAAATCGAAATTCCGTAAGTGGCTCTAATCCCATTGTTCTAAGCTCTGAAAGCTGCAAGACAGTAACGCACCGAACTCC
AGCACCAAGTCGAACGTGTCATCGAACTCCTTGCGGATCTCCTGGCGCAATGACAACTCAGGTTCCTCTTCTTTGGCTTTGCTCTGCGGCAAAGGAGAGT
GTCAAAGTCGAATCCATATCGAAACAACCGATTCAAGCACGAACCTTGTTCACGCGGGGCTTGCGCTCCTTCCACGTCTCGGTGGGCACTCGAACACCTG
CACTTTCTTCTTCTTACCGCTCGCCACGGGGAACTGGAACGCCATCTTCGACTCTGGTGATGGTCGACGCCAACCAAATGCTAGCGCTAAACTATGCTGC
ATAAATGTGGACCACATAAACATCAAACCGTGACGCGCGCAACAGATCGTACTATTTTGCTCGAGAATGCACTATTGTTACTACAGGTTCGTCGCTACAG
TTCAGACCAGAACTTGCACCTGGAACAGACACTGCTGGCTGCTACACGCTCGTCGCCGTTATGACTGTCCAGCTCGTCCAACTCGTCTTCAGCGTCACTT
TCACTCCTTCGCGTAGAAGCTGCTTCCGAGGTCGAGCCAAAACTGTCCCGTCCGCTGACCGATTCATCGCGAACGAATCCACCTTGTTATCGCTCTTTGT
TTCCTGCTCAAAGTCATAGAAGCCGCGGCTTTTGTGACGCGGCTGCTTCGTAGAGGATTCGCACGGCGGTTGTCGTTATCCACGTCTGTCCGCTGCGGTC
GGAGAGGCAGTAGCGCGCGGTGCTGGTCCGTTTTGTTTTGATTTTGCGACTTAGGGCTCAAGGGAACGAGACGCTTTCAACCAAAGACTGGTTTAGCACA
CTTTCGTCGCACGCTGGACTGCAGGAATCGGCCGATATCGGGACAATCGCTGAAGCGAGGAGACTCCATAGCATTGACTGTCATTACGTTTGTCCGGTGT
TGGCGCTGAAAGTCGGCCATGGACATCGGACTTGGTGGCTTTCTTCGTCGCCCTTGCACTGCGGGGTGAGCTTGGTCGTCCTGAATATTCAATTTCTCCT
AGGTCTCGCGAAGCTGATCAACCGTGAGAACGTCTGCGCTTCGGGAACATCGGCTGACCGATCCGGAAGTGCAATACCACCACGCGCAATATTCGATTCA
AATCCGACAGACTGAACTGGTGCCAGTCGATGCTGATACGAAACAGCCTGGTACTGATCCTGTTGCTGAGCTTGCTGCAGGGTTTGTCGAGCCTGCTGGG
TCTGGAGGTCCGTGTGGTGTTGCTCGTTAAGGGCTCGTTGTGCATCAACAAGACTAGCCATTTTCTCGTTCTCAAGTTGCAGCAACGCCCGTTGCACACG
CAGTTCTTCTTTCTCGCGTCGAACCTCATCCCGTTCTCTCCGCAGCTCCTCTCGTTCACGGCGAATTTCTACCAGCAGCGAGCGGTACTCATCAATCATA
CGGCTCTGCTGCTCCAGTTGCTGGCGTGACTCCTGAGCGTCGTTCTCTTGAGGATATAAATGTCTCCCTACTATGCCATTGGCCGGGCTTCGATCAAAGG
TGTCGCGTCCGCCATCATTCGCACTACTCCGCTCGATACCTAGTTGCATCTGAATCCGCGAAGGAGCAGGAGGAGGCAGCAGTGTTTCTGCAGGGCCCGT
GCTCCCATAATGACGGTCTCTCTGATAATAAACCGCCTTGTCTTCTTCCCGTGGGTCTCTGTCGAATGCAAAATTGTGACGACTGCTTGCAGTCGGTTGA
AAGTCGTTCCTCTGTCGATCCGTCAGATCTGGCGGTGGCGGCAGCGTCTGAGGGTACGGAGAGTTCATCTCTGCCCTATTGTCGTTCAGCTGAGCATTCA
CCACCGGTGAGAAATGCCCCAGTTTCCGCTGCGCTCGCAGCTGCTGCTCTCGGAGGAAGCGCATCTCTTCCCTCGCCGCGTCCTCCTCGCCGCGTCGCCG
CTCCGCCTGCTGCAACTCCTTCAGCCGCGCCTTCTCCTGCACCTGTTCATCCAGCATCCTCTTCCACTGCATCTGCTGTGCGCGTTCTCGCAGCCTCTGA
CTGGTCTCGCTCTCGTCTGTCACTCGGAAGCGCGGGTGGGACGACGAAACGCTGTTGGCTTCCCCCGTCGCGGCACCGCGGTCTTGTCGTTGCTCGTCGT
GCAGTTCCACGCTCTGCTCGAACTTCCAGGGCGACTGGGAGGCCGCTGGCAGCTCGAAATGGCCGCCTTCGACCAGCCACTTGGCCGGCGAACGCTCGCT
CGGCGCCAGCTTGCGCTCCAGCTCCTCGCGCTCCATCTGCTCCTGGTGCTGGCGTGCGCGACGCAGCGCGATCTGGTGGTCCAGCTCCCGCGCGTAGGCC
TCTCTTCGGCGCTGGATCTCGCGCGGGTCCTCGTCGTTGGCGCCCGAGTCCGCAGACCACATGAGGGCTCAGATTCCTCCGGCAGAAATTGTCGAACGTT
TTGGTTTGAAGCAGTTTTTGAGAGGGAAGGCGTTTGATTGGAGGATAATAGAAATTTGGACTGGTACAGCAACCTGACCAGGAACGGACCTTCCTAGAAG
TTCAACGAGTTGCCAAACAGACACGAGTCGGCGTACTCGCGTCGCAGATCGACCATTAGCTTTTCCACTTGCAAGTCGCTGCGTTGACACTCAGATTGCA
GCAGTTGGAAGCGAAGTGACACGTCACTCTGGAAGCGACGCAGCCTCTTGCGCTCCTTCTTGGCCCCATCTCGTCGAGGTCGGCGGTGGTGACTGCCGCT
CCGACGTCGGTGCTGTTTGTGGCTGCTGCAGTCGCTTTCGCTGCTGCTGCCGCCCACGTCGCTGTCATAGTCCTCACTCTCAGCTTGAGGCCGCGCAGCA
TCTTCTGGATACGGACGCGCTCTTTTCTGCGGCGTTCGCACTGGTCCAGATTGCGTAGCAGCGCATCATGTTCTCGCTGCAAGCTGTCGAGTCGGTCCTG
GCCGCGCTGGAACGTCTGCTCTTCTCTGCTGAGCCACTGCTTCTTGCGCTCCACCTCCCCATACAGTTCCGTCAGTATCTCGTGGACTTCCGCGTCGTCG
GTGCCACGCGTGTTTTCGCTCTGCGTCAAGTACAGCGTCTTGTGCTGGGAACTGCCATTGCTTGTCCCTCGACCGCTCGATATTTGCTCCTGTGTGCGCA
CTCGGAACACGACAGATTTCTCTGTGGTGCGCACGACACTACGGCGGGAACATCGCTGGCTACTTTGCGTGGGAGACCAAGCGGGGGAAGCACTGCGGCC
CCGGGAGTGAGTGCTGGACGACGAGCTCGCGGTGCCGCTCATTGATCGTTGCGGTCCAAGATTTGAGTGACGAAGTGAAAATCTCTGTTGAAACCCTTGA
ACAATTAATAATTTCGCTAAGTGAACATTAGTGAATTTGTATCGGGAACAAATTCTCAAATCAGGTAGCCTTCTGAAAACAGATATGAAGCAATGTATCG
ACTTTGTCAAAATTGCAGCTTTTTGCTGTGCATCGAATTGATTGTCTAGCTGTTGCAAGGCCGTTCCTGTCTAAGCTTCTTGTGCTGCGAGTAGCGATCT
TTGCTGGTCACTGCATAGTCCTCGATGAAGCAACACATTTATAGTTCGCTGTGAGGGACGGGTTTGCTGGTGGGGATCGGCGAGATCATGGGCGAAAAGA
TGGGGCGAGAAGTGTGCATCAGCGCCGTCGAGTGCGCCCCGCCTGCGGAGACCTGGCGGACAGGGATCGGACCAAGGTCTAGACGCGTAGGCACGGCGAG
CGGCTTCATATCCGTCAAACCCAGTCGTCCGTGGCTGCAAGAGTCAAGAAAAACAGGGCGAGATTAGCGTTTCCTCCTTGTCAAGCCAACTCGGCTGAAC
AACGTACTCGGGTCGTCCCGCGACGTAGGCAATGCCGTCGCTCGTGACGAACAGAGTGTGAGAGCCACCACATGCAGCTTGAATCACCGTTTTGCCCTTC
AACGCCTTCACCTGTTGAGGTAGAAACATCGAGACGTCAACAATGATTGCAATACTCAAGCAACCAGCGCTCCGTACCAAGTGAGGTCGCGTTCGACTCT
TTGTGTCGCCAAGACCGAGTCGGCCATACTCGCCACGCCCGAAAGCATAGCAGTCTCCCGACTTGGCCACCACCGTAGTGTGCCAACCACCACATGACAC
ACGCCTGTACAGTCCCGAAGAACACAACAATCGTTAGCATATTAAAATCCGCACATAGGTAAGCGACAAGACAAGCAGCTTACAGTGCCGGAATGGCATC
GAAAAACTCGACTCTTTGGGCGTCTGCTGATCGGACGTCTGGCCAACGCCAAGCATCCCGTAGTCCTCTTTTCCCCAAATGTACACGTGCCCTTCCTCGG
TCACAGCAGCCGAGTGGAAAGCACCGCAAGCGACTTGCACGACCTTCTCGCCGTTAAAACCTTCAAGCAATCGTGGTCGGCTGACTCCCAGAAGTCCCTC
GTCCTCCGTGTCCTTCAGCCACGCAGCCCCGATGCCCAGTTGGCCGCTATCACCTCGACCCCAGACGTAGACGCGCCCCAAGCTGGTCAACGCAGCCGTG
TGCGTCCCGCCGCAGCTGATTTTTAGGATCTTTTCGTTTGCATTGCCTTCCGGCATCGGGCACTTGACCGGCAGCGACTCGTGCGCCGCCTCGAACTCCT
TGGGCAGACCCAACTGTCCCCAATGCGACTCGCCCCACATGTACAGCGTCCCGTCATTGGTCACAGCAGCAGAGTGGCAGCCTCCACACGAGATATAATC
CACCACGAGTCCATCCAGCTCAAAGAAAGCGATCTTCTGCGGCTCATTAATACTCTTGAGGTCTCCGTGGCCCAGTTGACCCATCTGCACAAAGCACAAA
GCGCATCCAGTGAGTACGTCGAGCAATGCGCGCAAGAGGTGGCGGGGAGCGCACCGATCCCCATCCCCACGAATACACAGTGCCGGCAGCCGTGAGCGCC
ATCGTGTGGCGGGAGCCGCAAGAGACCGCGATGATCTCCTCGCCCGCCAGACCGTCAAGCTGGTTGGGGAAGTTGGAGGCCGACACGTCGTCGAGCGCCA
GCGTCGGTCGGCGCTTGGCACCCGTGCCCAGCTGCCCGTCGTCGTTACAGCCGAACGCTATCACCGCGCATTGCGTGGCGCCCGTCGAGATGCTCATCGT
CTTGATGCTGGTTGGCAGTCTTGTTGAATGCAAAATTGAATGCAAATGCCAGCGAAAACCTGTTCAGATCGATTTGTATTGTTGTATTTGTTTGTATAAG
TCGTATTTGTACCTAAAGATGAATACATAACACAAAACGTACATGTAACTTCAACATTGACGATCGTCCACGGGGACCTGTGTGGACGCTTCCGTTATAG
GAGCGTACATCTGCGCCTTGAGAATGTGGACTCGAGGGCCGCGAAGTCGACCGCGCTTGCCCTCGAGCTGGCGCTTGATCTGCGCGAAGCGAATAGCGTT
CGGGTTCCGAGGCGGCATGGTACCGCTCCACGCCTTGGACTCGCCAGTACTTCTATCGTTGCTACTGCTACTTTTGAGTGAGTGCTGGATATGCGAGTGA
GTTTCCGGTCCCAAGGCGCCTTCGTCGTCCTCGTCGATAGAGTTGATTCCGTATTTCTTGGCTGTGTTGGTGAGCGACGGCACGAGCATGCGCGTGGTGC
GGTTGATCTGGAATTGCTGCTTGTACTTAGCCATCAGGCGTTGACGGAAGGCTAAGGCCTTCGCCTGTTGCTCACGCGCCGCCATTTCTCGGCGGTAAGC
TTCACGTTGAGTCGGGTACTTGGTGCTCACCTGCAACGCTCGACAACGACGGCGACTTGCATCGCCACGCACTAACCGTTGAATCTTCACAGCTGGAGAC
TGCCGAATACTTTTCAACCATCCTTTCTGCCGCTTGTACTCGCGAAATACCACGCGCGTGGTTAGTCCTCGCCAGTGCGCCTGGATACGGCTGACCAGGG
CATGCTCGCGACGCAGAACGCGCCTCGTGATTTCCAGCACGTTGTTCTCCACCTTTATCAGTGTCGGCCTGCCACCTGATCGACGCACATATTCTCTGTA
GTTCCAGTAAAAGACGCTAAGCTCTGCTGTGTTCGTGTACCAGAAGACCGGTGGCTCGTTGGGTCGACTCGCTAAAGCGTAACTAAGTATCTGCGGTGCC
ATGAAGCTGATTATCCGTAGACACCGCTCGATCACCGTTCGTCTCCGCGCCTGCATCCCCCGTACCCGGGTTTGAATCCTTGTGGCCGCTCGATTGATCT
TCCGCAGATATCGATCACGCGCTACCAGGCGACGACGGAATTCCAGGCGTCCCAGAAATCCCCTCGCGATACGCTGGAGCAGTGCAGTTGCCGGGACACG
TCGACGTTCGAACTCCTTGATGGCATTTCGCTCTTCCTCGATCTGTTCCTGGAAGCTCACGACCCCTGCGCGTAGATACCGAGTGCTGCCACACCCTGGG
CATTTCGGTACTTCTTCATACAGAAACGTCGTGTCTTCTCTTTCGCCCAACTGGTCTGCCTTGCGCCGTACTCGCAGCACGTCGATGAACGTCACGCTAT
TGCATCGTTGGCAGGTCAGGTACGGTGTCATGGTACTGAGCAAGTCGTCATGGCTGAGCTCCGGCTTTTGGTCGAGAGCATTTTCGACGTTATCAGGAGT
CGTGTCGACAGTCGAAGCTGCGTTTGGTGAAGGGATCTCGGCATTAGTCTGAGCGATTGAGTCGCTGCTCACTGTTGGATGTGGGTTGCCTGGTTGTGAA
GAGTTGGGCATGGTCCTCGAGCTGCCAGCGAGCCATGGAGTCGGGTCACACTTGTGCACCCCTTCGCTAACCGATTTTCACGACTGGATACCAGTGGGTG
CAACTGAAAATACTAAGCAAGAGTGGTTCGTGTTTCATGTGCTAAACGCAAGTTGTGCAGCCATCCAACCTTATTCGTCGTCGGCGATGTCTTCTTCCAT
TTCGTCCTCAATCTCATCGTCTCCAGGACGCCCCATCTTGTCGTCGCGCGAGTTTGGACGACTCATTTGCGCCTCACGAGAACCTGGGCGACTACTGGGA
GCCTCACGCGAGGCAGGACGCGATTCTGGGCGACTGGATTTGGCATCACGCGAACCGGGTCGGTTGGACGAAGCAGACTGCTTGTAGTCACTGGGCGAGG
GTCTGCGGCGTCGGTCGTCACCCAGAGAAACGCCTAACTTCGCTTGCACGGACTCCACCACCCGTGGGTCGACGTAAGTCTTGATTGTGAGCCCCTTACG
GTTCATCTCCTCCATCGTCTCAAAGCTCTTGTTCAGCTCGCCTTCTTCGTAGTACGCTTCTGTTAGCATTGCATATGCGTCGCCCACACGGATAGCCTCC
TCAATACCTGGTTCCTCCAGCAGTTTGGTGACAATGTCCATCATCTCTTTCGGGTTGTGCTTCACTTGCTGTCGGGCGACGACGAATTGCTCGATCAGCA
GAATGCGCTTCTCATAACGCTTCAGCAGTGCTTCCTTGCCGTCTGCGCGAGATTTGGACACCACCTGAACGGCTTCTTGCAACGCAGAAATTGCCTTCTC
GTAGTCGCGATATTCCTCGATTTCCACCTGAGCACAACCGGCATAGAAGGCTGCAAGCTGCTCGAATGCACGTGCTTTAGTGTAGAACCCCATGATATTC
TTCAGGATTTCCGGGTCCTTGCGCCAATCCAAATTCTGCAAGTAGTTCGCAGCCAGAACGAAGATTTGGGCGTTGCGCGATACGTTAGCAAAGAACACGA
CCTTCTCAGTGTCGCCGGACTTGAGCAGACATTTCATGGCCTTAAGCTTGTTGCCGGCTTGAGTGTACTTCTTCGTGGCCAAGTGATACGAGCCTTGCTG
CTTGCAGCACTTGGCAAGCTTAAGCAGTAGCTCAGTGCGCTTCTTCTTGTCAGCCGGCGACGCGGTGTCATCACCTTTGGGAGGCGTCATCTTCTCCGCC
ATCTCTTCAGTAACCTTCACATCGTGTTGCATGCACACATCCAGAGCCTCTGCAACGCGATGTCCGATCAAGCACAAGTGCACGGCCTTAGCGAAATGAC
CGTTTGCGATGAAGAAATCAGCGCATTTTTTCAAGATAGCGGGCGAAGTGTTGCCAGAGCCACTGAGTTCGTCCGTGAGGTGATGCAGCTCCTCAAAGAG
TTGGGCCTGGAAACACAAATCGAGGGCCCTAGCCACGTTTCCTCCTTTGTGGTACAGCTGGACGGCTTTCTCCATTTCATGTTGCTCTTCGAAGTATGCA
GCACAATCAAGCATATCACTGGGCTTGCTCATGAGCGCGAAGCCCATGAGGTCGGCGTCCATGCGGTGCTCCTTGGCCAGACGAATGGCATGGTTGTAGC
AACCACCGCTTGCGAAGAAATGGATAGCGTTGGAAATTTCGTTGTGCGCCTCGAATTGCCGGGCCAGATGATACGCTGCTGCGCGATTCCCGCTCGTCTG
TGCTACTTTCGCAGCCGTCTGGAAGTCTTTCTTGAAACACAAGACGCGTACAATGGACAGGTAGTCCTTGGCACGCTGATAGCTTTCTACGGCAGCATCA
AATTGTCCCTGGCTCTCTTGGAACTGAGCCCACCAAATTAGCAGGTCGCGGTTGTTTGAAGTTGCTACGTACTTCTGGAGTATGTCCACCTTGCCCAGCT
TGAATAGCATGCGAGGAATATCCTTTTGATGAGTGCCAGCATCCTCGTAGGCTTCCATCGCCTCCTTCAGATCTCCCATTTCCTCGTAGTGTCGTGCCAG
TGCGTGGTAAGTTGTCTTGAGATGAATGCGGTCGCGCTTGGCCGCTACATCAACAGCCTTTTTCCAGTATCCGCTGGCCTGATAGAGTTTGTTCAGGAGG
TCGTAGCGGCCGCACTCACGGTACAAACGGGCTGCATCGTCGCGAAGGCCTAGTTGAATTGCTACCATGGCAATCGCAACTTCGAGCTCAGGTTCTCTCT
TTGCCTCTTGCACTGCAGCCGCACCTCGAGCATGGCCCATATTCCCGAGACATACCTCAGCCACATCCAGCCGCTTCGTCTTCACGCACATGCGCGCCAT
GTTCTCCCAGACGGACGGATTTTCAATGAGTTTGACTGAGCGGTACGCTTCATCCATATTACCGACCGTCATGAAGTAGCAAAAGTCGATTAGAGCTTGC
TTCGCCTCATTGTTGACCTTATCCAGCCCCGTGAAGTCGCGCATGATCTGTGTGCGAAGATAGCTAATGGTGTCGTAAACCATGGGAGTTTTAGTGACGG
GGTTGTTAGCCTTGGTCCGGCCAACATGCACTACGGTTGTGGAGTCATCTGATGAGCTGTTGTCCACCTTTGCCACGAAATATACACGTGGAACTTGAAT
ACCTAGTAGCGCGGAGTACTTCAGATCAAGGTCAAAAACTGTCTTGCATCAGTAGGCCGTGCTCGTTTGACGCAAAAATGATGGTGACCTCCTTGTCTGA
GACTTGGTTCCCGCGCGCACCACCGGGACCACCAGTCCCAACCGTCGTCGGTACGACCAGCAGCAGCTCCACCCGATGTCGTCGACGCACTATCATTACT
GTCTTGACAGTCTCGCAGATAAGCAACCGTGGCTCTTGAGGATCGAAGAAAGCTGAGGTCGGGTAGCGTGAAGAGCCAAAGTCAAACTGCTGGTAAATGT
TGAGATCCGTTTGAAACAGAAAAGCTTGTTCAATGGTTCTCGCATTAGCAAAGCACCTTCAACGCGGTCAGCAAGAATGCAGATGCGAGTGCCGTCCGAG
TTGACACAGATTGCTCGCATCACAGCAGACTTGGTCTCTTCTCCAAAAGCTTCGGGGAGATTTCCCATGCTTCCTAAAGCTTTGGGGTCACGGCGGGATA
CGTCGAATACGCGCAATAGGCCCCGATCCGTACCCACAGCAAGAAACTTGTTCTGAAGTGACAGCATCGCCGGCCGGCCTTCGGCTTCCGTGAACGAAAT
GGTGTTTTTCACTACTCCTGCAAGGTTACAAACCTCGACATGATTTCCGTTTGCCCGATAAATGGATTCACCGCGAAGCACCATAGCACTCGAAAAACAC
TTGAACTGATTAGTGACTTTGGCATCTCCATCTTTCATTTCGTACACTTCTGCTTTTGATCCGTTCCAAACAACGAGCGTTGATCCGTCGTGGGAAACAC
CCTTCACACATAGCGATGCTTCAAGTGTCGACTGTGTGATTGTCACACCAGACTGCGCTCCATCTTGGAACTTCTCGATTGAGAGTGTCTTCGGTCGGAT
TTGAATGACTGATGTATCTCCACTAAGTGCACGCTGCATGTTGCCCTCATGTAAAATGACCACTCCTTCGACGGTGTTGGCGTACAACGCAGGGTGGGCA
TTGCTCCAGCCGATACGTGTGACTGCACGACCCACTTCTGCCGTGAAGAGCAAGTCCCATCGGTACGACACATTTGCGGAGTCTCCAGTACCTTGCGTCG
TGTCAATGAAAGACGTGGCACGCCAAAAAAAACTGCCCTTGAGCTGTACCCGCCACGAGAACGCGCCTTCGCGGGGAAAAACTCAAATTGTTGACGTTGT
AATTGAGTCCACTTGACTTTGGTAGACTCAATACACTGTTCTCTTCAGTACGAATGTTCCAGAACCGCACAAGTGGTTCGCCAGACGCAATTGCTAGTAG
CCCCGGACTAGCCCACTTTGTTTCCAGCAGTGAACCTTCTCCCGCTAGACTCAGCTTGACTTTAGTAATTGGCTTTACTGTGCCGTCCGTGACGCCCACT
TGATACACGATAAGCTGCACCGCCCGTGTGATGACAATGAGGCGGCTTTGCTCCTCGAAAAACATCATCGACTCAATTGCGTGGTTTAGCACCTGAATGT
CCGAAATGTGGCCCAAATCGTCGGCATAGTGTACAGACCCCATCTCACCACCGAAAAAGAACTGTGGACACGCGTGCTGAGAAAAATGCTCCCTAAGCAA
CACAAAGACATCAAATCGAGGCAAATTAGCGCAATAGCTAGCAGAACCATTATGGAAAGTAACATATACTCACATTTTGGTGTGGCTGTCCTTTGGTGGC
GCTGATCGCGTGGCGAAGACACAGTGAGTGAAGCTACCTTGACGCGCATATTGCGTACTGAGGGTTAGCTGGCACCGACTATCCACCTTCCACACGGCAA
ATATTCCGTTCTCATCCGCAGACATGAGTCGATTCCCTGACGGGGACCACTTCAACAGACACACGCGGCTCGTGTGCGGCGAGTTCACTTCGCGCGCCGA
CTGTTCCTTGAATACCCACAGCGAGACCATACCTGGCCCGCACAAGCCAACAAGACTCAGTGCGCGTTGATAGTATTAATTCAAAGGCATCCAACATACC
GTCGCTCCATCCGACCGCGACAGCTCCGCACGAGGCTGCCAGGCCATCGAGACGATGTCGGCACTGCGCGAATAGCTCTCCAGACCTTGCTGCTTCTCAC
CCTACATCGAGTAAGGGACCATGCAACCGGTTAATGCTTCGGATCTATTGGTTACCCACCAAACTATTTGCTGCCAGTACCTCATCCGTGAAGAAGTGAA
TCTCTCGGTTCTCCAGCGCCACGGCCAGCACCGGGTCCAGCTCTCCCAGACCGAGCAGACCTGTCGCAAATTCGCCGGCACCTGCACATTGTAGTCGTAA
AACAATGCCATCGTGCACTCTCTCGCCTTGCCGCCACTAGATCTTCGAGTGCATTGCTCGCGTCGCTTCAAGATACAATATGCATTTGCATAGGTATGCT
TCACATGGTCATTATGTAGTCCACACTACGTGGTGTCTACACACACCACATTTGATCGAAGTTTGACTGGTTGGGCGGCCACTGGTCGTGAAAGGCTGCG
GGGCATTGCTGCATACTCAGGGACTATGGCGGTGCAAGCGAAAACGTCGGAGCCCAAGGCAAGAGCTTCCAAGGCAAGAGCTTCACCAAGGCCAAGAGCT
TCACCAAGGGCTTCAGTGGCAAGAAGCGCCCGGCCGGTGGCAATGGCGAGGACGGCAAGAAGTCGTTCATGGACCAGAAGCTGGCCAAGAAGCAGCGCAA
GATGCAGCGCCCGCACTACGAGATGGTGACGCGCGCCAAGCAGATCTGGAACGTCATCCGCGAGCGCGACGTGGAGAAGAGCAAGCGTGCTACGCTTGTG
GATGAACTGTACACGCTGGTGAAGGGCAAGATCTATGACGTGGCGGCGAAGCACGACGCCTCGCGCGTCATCCAGTCGCTCATGCAGTACGGCAAGCCCG
AGCACCGGTCGCAAATTGTGCTCGAGATGAAGGAGCACCTGATTGAGGTGGCCAAGATGCAGTACGGATGCTTCCTCGTGCAGAAGATGATCCGCTACGG
CAGCGTGTCCGACCGCGCCGCCATCGTCAAGTGCCTCTCAGGCCACGTTGTGCAGGTGGGCACGCACAACATTGCGGCTAATGTGCTCGAGTATGCACAG
GAGTATCTCAAGCCGTCGCACTTACGGCGCTCAAGCTCGAGTTCTACGGGCGCGAGTTCGCCTACTTCCACGAGGAGAGCAAACGCAACCTGGCTGACAT
CATCGCGGCGCACCCAGACAAGAAGGCGGACGTGCTCAAGCATCTGAGCACCATTCTCAACCGCATGGTCGACAAGCAGCTTCTTGGTTTGGCCTTCGTG
CAGTCCCTGCTGTGGGAATATCTGTGCAATGCTGAGCACGACGACGTGATGCAAATGGTGGCGAACGTGCGTGACGCTTCGTTGGCTCTGCTGGCTACGC
GCAACGGTGCTCGTGTAGTGAACAAGTGCCTGTCGCTTGGTGCGGCCAAGGACCGTAAACGCATTATTAAGGCTCTCAAGGACAAGGTGCTGGAGGCTTG
CAACCACCCCAGCGGTTACCTTGTGATCATGCGCATCCTGGATGTCGTTGATGACTCGGTTCTTGTGCAGAAGTCCGTTCTGGCGGAGATGAACGACGAA
CTCTTTTCGGTGGCGATGCACCCGAGCGGACGCAAGGTTCTACTCCAGCTGCTCAGCCCGTCGAACAAGAAGTACCTTTCGCCGGATGATCTTGCCCTGT
TGGAGCCTCCCATGCTTCCGTCGCCTGAGGACCCGAAGGTCTTGGTGGTGAACTACAAGAAGGACCCGGACGCTCGTCGCGAGGAACTCCTGAAGGGTCT
CCTGCCCAAACTGGAGGAGATGTGCGTGGAGAATGCCACTGCCCTGATGCGCTCGAAGGAGGGTCGTGACGTGATTGTTGAAGTTGCGAAGCGAAGTCAG
AGCTCTGATCTGGCGGACAGTGTGGCGGCCGCCGCGTTGGCGGAGCCTATCGAGGAGGAGGAGGCGCTTCACACTGATGCTAATGGCCACTTTGCTTTGC
GTCGTCTGATCAAGGAAACTTCGCTGGCGGAGCCTCTGCTTTCGGCCGTCGAAGGTCAGCTTCCGCAGTGGGCCTCCACCAACCGGGGTTCTTTCGTGGT
TCTTGCTTTCCTAGAGGCTGAGAAAGGACCCAAGAACGCTGCTAAGGTCGTCAAGAAGGCGCTCAAGCCTGCGATGGGAGACTTGAAGAAGCTCGTCGAC
CAGCAGAAGGGCACTAAATTACTTGTCGAGAAGCTCCAATAGAGAGGAGATAGCTCAAACTTTATAGATCCACAGGTTTTGTTTTCGTTGTGCACGCTCG
TTTGGGTTTCGGACAATATCTGGACTACATTTAATCCTGGTCGTCGCTATCGTCTTCGCTATCGTCGTCCTCAGATGTATCTGTAGCGCCACCTTCTTCT
TCGTCGCCCTCCTCGTCGCTGTCGTGAAACGCTACAATGGGGTTTCCTTCTCGCCAATTCTTCACCAGCTCCAAAATTTGTGGATGCTTGTGCAGAAAAG
CGAGGTAAGAGAGCGTTTCTCCAAACTATTCGAGCATTGTCTTGGGTTAGCGGGCATGTTTGATGATAACTTCAAGATTTTGTTGAGTTTACCTTGTTCG
GTTTATCCGCCAGCTCGGCATCGCACTGCTGTAGCATGTTCATCAGTAGATTTACGTTGCCACAGGTGGCCGCGTAGTGCAAAGCTGTCATGCCTTGGGC
CTGTCGTACCACAACGACCGCTTACTCTTAACCATTTCTGCCGAATAATGTTTTCAGAATTTTGCTGTGAGTCCTTGCACGTACATCTTGTAAGGTGAGA
TCTGAGCCAGCGTGCAGGAATACCATGCCTAGTTGGTGTAGAGGTGTTCCTCCTTCAGCACAGAGCA